ID: 1041925772 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:63234694-63234716 |
Sequence | CTCTCATGCTGATCACTAGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041925772_1041925774 | -8 | Left | 1041925772 | 8:63234694-63234716 | CCCACTAGTGATCAGCATGAGAG | No data | ||
Right | 1041925774 | 8:63234709-63234731 | CATGAGAGCTTTGACCCACTTGG | No data | ||||
1041925772_1041925779 | 25 | Left | 1041925772 | 8:63234694-63234716 | CCCACTAGTGATCAGCATGAGAG | No data | ||
Right | 1041925779 | 8:63234742-63234764 | GGACCAGTGCCCCACTTCTTAGG | No data | ||||
1041925772_1041925775 | 4 | Left | 1041925772 | 8:63234694-63234716 | CCCACTAGTGATCAGCATGAGAG | No data | ||
Right | 1041925775 | 8:63234721-63234743 | GACCCACTTGGTTTCCAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041925772 | Original CRISPR | CTCTCATGCTGATCACTAGT GGG (reversed) | Intergenic | ||