ID: 1041925772

View in Genome Browser
Species Human (GRCh38)
Location 8:63234694-63234716
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925772_1041925774 -8 Left 1041925772 8:63234694-63234716 CCCACTAGTGATCAGCATGAGAG No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data
1041925772_1041925779 25 Left 1041925772 8:63234694-63234716 CCCACTAGTGATCAGCATGAGAG No data
Right 1041925779 8:63234742-63234764 GGACCAGTGCCCCACTTCTTAGG No data
1041925772_1041925775 4 Left 1041925772 8:63234694-63234716 CCCACTAGTGATCAGCATGAGAG No data
Right 1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925772 Original CRISPR CTCTCATGCTGATCACTAGT GGG (reversed) Intergenic