ID: 1041925774

View in Genome Browser
Species Human (GRCh38)
Location 8:63234709-63234731
Sequence CATGAGAGCTTTGACCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925772_1041925774 -8 Left 1041925772 8:63234694-63234716 CCCACTAGTGATCAGCATGAGAG No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data
1041925769_1041925774 28 Left 1041925769 8:63234658-63234680 CCAGACTGGAGTGCAGTGGCCAT 0: 6
1: 111
2: 2065
3: 22337
4: 209287
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data
1041925768_1041925774 29 Left 1041925768 8:63234657-63234679 CCCAGACTGGAGTGCAGTGGCCA 0: 16
1: 675
2: 14485
3: 188405
4: 264537
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data
1041925773_1041925774 -9 Left 1041925773 8:63234695-63234717 CCACTAGTGATCAGCATGAGAGC No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data
1041925771_1041925774 9 Left 1041925771 8:63234677-63234699 CCATTCACAGGCGCTATCCCACT No data
Right 1041925774 8:63234709-63234731 CATGAGAGCTTTGACCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925774 Original CRISPR CATGAGAGCTTTGACCCACT TGG Intergenic
No off target data available for this crispr