ID: 1041925775

View in Genome Browser
Species Human (GRCh38)
Location 8:63234721-63234743
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925772_1041925775 4 Left 1041925772 8:63234694-63234716 CCCACTAGTGATCAGCATGAGAG No data
Right 1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG No data
1041925773_1041925775 3 Left 1041925773 8:63234695-63234717 CCACTAGTGATCAGCATGAGAGC No data
Right 1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG No data
1041925771_1041925775 21 Left 1041925771 8:63234677-63234699 CCATTCACAGGCGCTATCCCACT No data
Right 1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925775 Original CRISPR GACCCACTTGGTTTCCAAAC TGG Intergenic