ID: 1041925775 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:63234721-63234743 |
| Sequence | GACCCACTTGGTTTCCAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041925771_1041925775 | 21 | Left | 1041925771 | 8:63234677-63234699 | CCATTCACAGGCGCTATCCCACT | No data | ||
| Right | 1041925775 | 8:63234721-63234743 | GACCCACTTGGTTTCCAAACTGG | No data | ||||
| 1041925772_1041925775 | 4 | Left | 1041925772 | 8:63234694-63234716 | CCCACTAGTGATCAGCATGAGAG | No data | ||
| Right | 1041925775 | 8:63234721-63234743 | GACCCACTTGGTTTCCAAACTGG | No data | ||||
| 1041925773_1041925775 | 3 | Left | 1041925773 | 8:63234695-63234717 | CCACTAGTGATCAGCATGAGAGC | No data | ||
| Right | 1041925775 | 8:63234721-63234743 | GACCCACTTGGTTTCCAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041925775 | Original CRISPR | GACCCACTTGGTTTCCAAAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||