ID: 1041925776

View in Genome Browser
Species Human (GRCh38)
Location 8:63234723-63234745
Sequence GTCCAGTTTGGAAACCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925776_1041925779 -4 Left 1041925776 8:63234723-63234745 CCCACTTGGTTTCCAAACTGGAC No data
Right 1041925779 8:63234742-63234764 GGACCAGTGCCCCACTTCTTAGG No data
1041925776_1041925784 7 Left 1041925776 8:63234723-63234745 CCCACTTGGTTTCCAAACTGGAC No data
Right 1041925784 8:63234753-63234775 CCACTTCTTAGGCAACGTAGTGG No data
1041925776_1041925785 22 Left 1041925776 8:63234723-63234745 CCCACTTGGTTTCCAAACTGGAC No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925776 Original CRISPR GTCCAGTTTGGAAACCAAGT GGG (reversed) Intergenic