ID: 1041925777 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:63234724-63234746 |
| Sequence | GGTCCAGTTTGGAAACCAAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041925777_1041925779 | -5 | Left | 1041925777 | 8:63234724-63234746 | CCACTTGGTTTCCAAACTGGACC | No data | ||
| Right | 1041925779 | 8:63234742-63234764 | GGACCAGTGCCCCACTTCTTAGG | No data | ||||
| 1041925777_1041925785 | 21 | Left | 1041925777 | 8:63234724-63234746 | CCACTTGGTTTCCAAACTGGACC | No data | ||
| Right | 1041925785 | 8:63234768-63234790 | CGTAGTGGCCCTTTACTCTTTGG | No data | ||||
| 1041925777_1041925784 | 6 | Left | 1041925777 | 8:63234724-63234746 | CCACTTGGTTTCCAAACTGGACC | No data | ||
| Right | 1041925784 | 8:63234753-63234775 | CCACTTCTTAGGCAACGTAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041925777 | Original CRISPR | GGTCCAGTTTGGAAACCAAG TGG (reversed) | Intergenic | ||