ID: 1041925779

View in Genome Browser
Species Human (GRCh38)
Location 8:63234742-63234764
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925776_1041925779 -4 Left 1041925776 8:63234723-63234745 CCCACTTGGTTTCCAAACTGGAC No data
Right 1041925779 8:63234742-63234764 GGACCAGTGCCCCACTTCTTAGG No data
1041925773_1041925779 24 Left 1041925773 8:63234695-63234717 CCACTAGTGATCAGCATGAGAGC No data
Right 1041925779 8:63234742-63234764 GGACCAGTGCCCCACTTCTTAGG No data
1041925772_1041925779 25 Left 1041925772 8:63234694-63234716 CCCACTAGTGATCAGCATGAGAG No data
Right 1041925779 8:63234742-63234764 GGACCAGTGCCCCACTTCTTAGG No data
1041925777_1041925779 -5 Left 1041925777 8:63234724-63234746 CCACTTGGTTTCCAAACTGGACC No data
Right 1041925779 8:63234742-63234764 GGACCAGTGCCCCACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925779 Original CRISPR GGACCAGTGCCCCACTTCTT AGG Intergenic