ID: 1041925784

View in Genome Browser
Species Human (GRCh38)
Location 8:63234753-63234775
Sequence CCACTTCTTAGGCAACGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925777_1041925784 6 Left 1041925777 8:63234724-63234746 CCACTTGGTTTCCAAACTGGACC No data
Right 1041925784 8:63234753-63234775 CCACTTCTTAGGCAACGTAGTGG No data
1041925778_1041925784 -5 Left 1041925778 8:63234735-63234757 CCAAACTGGACCAGTGCCCCACT No data
Right 1041925784 8:63234753-63234775 CCACTTCTTAGGCAACGTAGTGG No data
1041925776_1041925784 7 Left 1041925776 8:63234723-63234745 CCCACTTGGTTTCCAAACTGGAC No data
Right 1041925784 8:63234753-63234775 CCACTTCTTAGGCAACGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925784 Original CRISPR CCACTTCTTAGGCAACGTAG TGG Intergenic