ID: 1041925785

View in Genome Browser
Species Human (GRCh38)
Location 8:63234768-63234790
Sequence CGTAGTGGCCCTTTACTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041925780_1041925785 0 Left 1041925780 8:63234745-63234767 CCAGTGCCCCACTTCTTAGGCAA No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data
1041925781_1041925785 -6 Left 1041925781 8:63234751-63234773 CCCCACTTCTTAGGCAACGTAGT No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data
1041925778_1041925785 10 Left 1041925778 8:63234735-63234757 CCAAACTGGACCAGTGCCCCACT No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data
1041925783_1041925785 -8 Left 1041925783 8:63234753-63234775 CCACTTCTTAGGCAACGTAGTGG No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data
1041925777_1041925785 21 Left 1041925777 8:63234724-63234746 CCACTTGGTTTCCAAACTGGACC No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data
1041925776_1041925785 22 Left 1041925776 8:63234723-63234745 CCCACTTGGTTTCCAAACTGGAC No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data
1041925782_1041925785 -7 Left 1041925782 8:63234752-63234774 CCCACTTCTTAGGCAACGTAGTG No data
Right 1041925785 8:63234768-63234790 CGTAGTGGCCCTTTACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041925785 Original CRISPR CGTAGTGGCCCTTTACTCTT TGG Intergenic