ID: 1041934554

View in Genome Browser
Species Human (GRCh38)
Location 8:63321338-63321360
Sequence GACAGCTCTCGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041934550_1041934554 16 Left 1041934550 8:63321299-63321321 CCCTGTCATCTTCTGCAGATAAC No data
Right 1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG No data
1041934551_1041934554 15 Left 1041934551 8:63321300-63321322 CCTGTCATCTTCTGCAGATAACT 0: 21
1: 199
2: 184
3: 120
4: 249
Right 1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041934554 Original CRISPR GACAGCTCTCGGCCTGTTAC TGG Intergenic
No off target data available for this crispr