ID: 1041938230

View in Genome Browser
Species Human (GRCh38)
Location 8:63358155-63358177
Sequence AATGAAAGGAAGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041938230_1041938234 1 Left 1041938230 8:63358155-63358177 CCTTCCACAGTCTTCCTTTCATT No data
Right 1041938234 8:63358179-63358201 AGCTCGTTTGGATCCTTCTTTGG No data
1041938230_1041938237 24 Left 1041938230 8:63358155-63358177 CCTTCCACAGTCTTCCTTTCATT No data
Right 1041938237 8:63358202-63358224 CAGTAATCTGGTATACCTCATGG No data
1041938230_1041938235 12 Left 1041938230 8:63358155-63358177 CCTTCCACAGTCTTCCTTTCATT No data
Right 1041938235 8:63358190-63358212 ATCCTTCTTTGGCAGTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041938230 Original CRISPR AATGAAAGGAAGACTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr