ID: 1041938933

View in Genome Browser
Species Human (GRCh38)
Location 8:63365852-63365874
Sequence GGGTGGCATCAGCTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041938933_1041938936 -9 Left 1041938933 8:63365852-63365874 CCATGCACCAGCTGATGCCACCC No data
Right 1041938936 8:63365866-63365888 ATGCCACCCGGACCTGTAACTGG No data
1041938933_1041938941 19 Left 1041938933 8:63365852-63365874 CCATGCACCAGCTGATGCCACCC No data
Right 1041938941 8:63365894-63365916 TAAATTCTGCAATCCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041938933 Original CRISPR GGGTGGCATCAGCTGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr