ID: 1041938933 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:63365852-63365874 |
| Sequence | GGGTGGCATCAGCTGGTGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041938933_1041938936 | -9 | Left | 1041938933 | 8:63365852-63365874 | CCATGCACCAGCTGATGCCACCC | No data | ||
| Right | 1041938936 | 8:63365866-63365888 | ATGCCACCCGGACCTGTAACTGG | No data | ||||
| 1041938933_1041938941 | 19 | Left | 1041938933 | 8:63365852-63365874 | CCATGCACCAGCTGATGCCACCC | No data | ||
| Right | 1041938941 | 8:63365894-63365916 | TAAATTCTGCAATCCTACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041938933 | Original CRISPR | GGGTGGCATCAGCTGGTGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||