ID: 1041940037

View in Genome Browser
Species Human (GRCh38)
Location 8:63377082-63377104
Sequence TCCCTTAGCTGTAGTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041940034_1041940037 7 Left 1041940034 8:63377052-63377074 CCTTGAAAATTATCGTAATTTAT No data
Right 1041940037 8:63377082-63377104 TCCCTTAGCTGTAGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041940037 Original CRISPR TCCCTTAGCTGTAGTTTTGG TGG Intergenic