ID: 1041945076

View in Genome Browser
Species Human (GRCh38)
Location 8:63431888-63431910
Sequence AGAGGTATCCATTTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041945076_1041945086 30 Left 1041945076 8:63431888-63431910 CCTTCCCCAAAATGGATACCTCT No data
Right 1041945086 8:63431941-63431963 ATTGTATGGCTCACACATCAGGG No data
1041945076_1041945081 -6 Left 1041945076 8:63431888-63431910 CCTTCCCCAAAATGGATACCTCT No data
Right 1041945081 8:63431905-63431927 ACCTCTAGCATCATAGGATATGG No data
1041945076_1041945085 29 Left 1041945076 8:63431888-63431910 CCTTCCCCAAAATGGATACCTCT No data
Right 1041945085 8:63431940-63431962 CATTGTATGGCTCACACATCAGG No data
1041945076_1041945084 16 Left 1041945076 8:63431888-63431910 CCTTCCCCAAAATGGATACCTCT No data
Right 1041945084 8:63431927-63431949 GCTGCTATGGATGCATTGTATGG No data
1041945076_1041945083 3 Left 1041945076 8:63431888-63431910 CCTTCCCCAAAATGGATACCTCT No data
Right 1041945083 8:63431914-63431936 ATCATAGGATATGGCTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041945076 Original CRISPR AGAGGTATCCATTTTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr