ID: 1041945245

View in Genome Browser
Species Human (GRCh38)
Location 8:63433610-63433632
Sequence TGCCAAACAGCAGTGTTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041945237_1041945245 24 Left 1041945237 8:63433563-63433585 CCTAGAAGAAGCCCTGAGCAGAG No data
Right 1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG No data
1041945239_1041945245 12 Left 1041945239 8:63433575-63433597 CCTGAGCAGAGCATTTCCAACGT No data
Right 1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG No data
1041945243_1041945245 -4 Left 1041945243 8:63433591-63433613 CCAACGTGGTGCAGGGATATGCC No data
Right 1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG No data
1041945238_1041945245 13 Left 1041945238 8:63433574-63433596 CCCTGAGCAGAGCATTTCCAACG No data
Right 1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041945245 Original CRISPR TGCCAAACAGCAGTGTTGAA GGG Intergenic
No off target data available for this crispr