ID: 1041945264

View in Genome Browser
Species Human (GRCh38)
Location 8:63433698-63433720
Sequence CAGGGAATATGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041945257_1041945264 6 Left 1041945257 8:63433669-63433691 CCCTGAGGGAGGTATGTGCTGGA No data
Right 1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG No data
1041945258_1041945264 5 Left 1041945258 8:63433670-63433692 CCTGAGGGAGGTATGTGCTGGAT No data
Right 1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041945264 Original CRISPR CAGGGAATATGGAGAGCAGA GGG Intergenic
No off target data available for this crispr