ID: 1041946583

View in Genome Browser
Species Human (GRCh38)
Location 8:63450431-63450453
Sequence GGAAAGAATAGGTCTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041946583_1041946586 -1 Left 1041946583 8:63450431-63450453 CCATGTTCAGACCTATTCTTTCC No data
Right 1041946586 8:63450453-63450475 CTTCTGATATCCCATTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041946583 Original CRISPR GGAAAGAATAGGTCTGAACA TGG (reversed) Intergenic
No off target data available for this crispr