ID: 1041947644

View in Genome Browser
Species Human (GRCh38)
Location 8:63464182-63464204
Sequence AATAAAGCACAGAAGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041947644_1041947646 16 Left 1041947644 8:63464182-63464204 CCAGGCACCTTCTGTGCTTTATT No data
Right 1041947646 8:63464221-63464243 ACAGCTATGAGTCTGTAAAGTGG No data
1041947644_1041947647 17 Left 1041947644 8:63464182-63464204 CCAGGCACCTTCTGTGCTTTATT No data
Right 1041947647 8:63464222-63464244 CAGCTATGAGTCTGTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041947644 Original CRISPR AATAAAGCACAGAAGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr