ID: 1041954579

View in Genome Browser
Species Human (GRCh38)
Location 8:63543283-63543305
Sequence AGCGGCTCCTCTTCTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041954576_1041954579 -3 Left 1041954576 8:63543263-63543285 CCAACTTGGGGACCTCTCAGAGC No data
Right 1041954579 8:63543283-63543305 AGCGGCTCCTCTTCTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041954579 Original CRISPR AGCGGCTCCTCTTCTTTCCC AGG Intergenic
No off target data available for this crispr