ID: 1041956843

View in Genome Browser
Species Human (GRCh38)
Location 8:63565761-63565783
Sequence TATTCCTGACGGAGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041956843_1041956849 -1 Left 1041956843 8:63565761-63565783 CCTGCCAGCCTCCGTCAGGAATA No data
Right 1041956849 8:63565783-63565805 AATGGCGTCACATAATTCCAGGG No data
1041956843_1041956850 7 Left 1041956843 8:63565761-63565783 CCTGCCAGCCTCCGTCAGGAATA No data
Right 1041956850 8:63565791-63565813 CACATAATTCCAGGGTTAAATGG No data
1041956843_1041956852 15 Left 1041956843 8:63565761-63565783 CCTGCCAGCCTCCGTCAGGAATA No data
Right 1041956852 8:63565799-63565821 TCCAGGGTTAAATGGGAAGTAGG No data
1041956843_1041956851 8 Left 1041956843 8:63565761-63565783 CCTGCCAGCCTCCGTCAGGAATA No data
Right 1041956851 8:63565792-63565814 ACATAATTCCAGGGTTAAATGGG No data
1041956843_1041956848 -2 Left 1041956843 8:63565761-63565783 CCTGCCAGCCTCCGTCAGGAATA No data
Right 1041956848 8:63565782-63565804 TAATGGCGTCACATAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041956843 Original CRISPR TATTCCTGACGGAGGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr