ID: 1041963091

View in Genome Browser
Species Human (GRCh38)
Location 8:63642552-63642574
Sequence CTGTAAAGGAGAAGGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041963091_1041963094 5 Left 1041963091 8:63642552-63642574 CCTGCTCACCTTCTCCTTTACAG No data
Right 1041963094 8:63642580-63642602 CACTTCCCCTCCTTCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041963091 Original CRISPR CTGTAAAGGAGAAGGTGAGC AGG (reversed) Intergenic
No off target data available for this crispr