ID: 1041963370

View in Genome Browser
Species Human (GRCh38)
Location 8:63646480-63646502
Sequence GCATTGTCACATTTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041963367_1041963370 10 Left 1041963367 8:63646447-63646469 CCTATTCGTTAGAACGACTCAGC No data
Right 1041963370 8:63646480-63646502 GCATTGTCACATTTTCAGCTGGG No data
1041963365_1041963370 23 Left 1041963365 8:63646434-63646456 CCACAGCAAAAGCCCTATTCGTT No data
Right 1041963370 8:63646480-63646502 GCATTGTCACATTTTCAGCTGGG No data
1041963366_1041963370 11 Left 1041963366 8:63646446-63646468 CCCTATTCGTTAGAACGACTCAG No data
Right 1041963370 8:63646480-63646502 GCATTGTCACATTTTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041963370 Original CRISPR GCATTGTCACATTTTCAGCT GGG Intergenic
No off target data available for this crispr