ID: 1041968232

View in Genome Browser
Species Human (GRCh38)
Location 8:63705545-63705567
Sequence GCCTGCCCAGCTCAACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041968232_1041968241 27 Left 1041968232 8:63705545-63705567 CCTGACAGTTGAGCTGGGCAGGC No data
Right 1041968241 8:63705595-63705617 TATTCGGATATTCGGCACAGGGG No data
1041968232_1041968240 26 Left 1041968232 8:63705545-63705567 CCTGACAGTTGAGCTGGGCAGGC No data
Right 1041968240 8:63705594-63705616 ATATTCGGATATTCGGCACAGGG No data
1041968232_1041968237 19 Left 1041968232 8:63705545-63705567 CCTGACAGTTGAGCTGGGCAGGC No data
Right 1041968237 8:63705587-63705609 TGCCGCGATATTCGGATATTCGG No data
1041968232_1041968242 28 Left 1041968232 8:63705545-63705567 CCTGACAGTTGAGCTGGGCAGGC No data
Right 1041968242 8:63705596-63705618 ATTCGGATATTCGGCACAGGGGG No data
1041968232_1041968235 11 Left 1041968232 8:63705545-63705567 CCTGACAGTTGAGCTGGGCAGGC No data
Right 1041968235 8:63705579-63705601 CTCCGCGCTGCCGCGATATTCGG No data
1041968232_1041968239 25 Left 1041968232 8:63705545-63705567 CCTGACAGTTGAGCTGGGCAGGC No data
Right 1041968239 8:63705593-63705615 GATATTCGGATATTCGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041968232 Original CRISPR GCCTGCCCAGCTCAACTGTC AGG (reversed) Intergenic
No off target data available for this crispr