ID: 1041991287

View in Genome Browser
Species Human (GRCh38)
Location 8:63995043-63995065
Sequence TTGAAGATGAATAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041991286_1041991287 -6 Left 1041991286 8:63995026-63995048 CCAATAGGACTTGATGATTGAAG No data
Right 1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041991287 Original CRISPR TTGAAGATGAATAAGTATGA AGG Intergenic
No off target data available for this crispr