ID: 1041993669

View in Genome Browser
Species Human (GRCh38)
Location 8:64026556-64026578
Sequence ACCTGCAGGAAAATAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041993669_1041993674 21 Left 1041993669 8:64026556-64026578 CCCTGGGTTATTTTCCTGCAGGT No data
Right 1041993674 8:64026600-64026622 CCCTTTAATATTTCTTCTTAGGG No data
1041993669_1041993672 20 Left 1041993669 8:64026556-64026578 CCCTGGGTTATTTTCCTGCAGGT No data
Right 1041993672 8:64026599-64026621 ACCCTTTAATATTTCTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041993669 Original CRISPR ACCTGCAGGAAAATAACCCA GGG (reversed) Intergenic
No off target data available for this crispr