ID: 1042002848

View in Genome Browser
Species Human (GRCh38)
Location 8:64145720-64145742
Sequence CACTTTGAAGGAGGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042002842_1042002848 2 Left 1042002842 8:64145695-64145717 CCTCTGGCTGGAAGCCAAAAGCA No data
Right 1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG No data
1042002839_1042002848 28 Left 1042002839 8:64145669-64145691 CCATTCTGACAGGCTGGGAAGCA 0: 31
1: 55
2: 102
3: 125
4: 301
Right 1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042002848 Original CRISPR CACTTTGAAGGAGGGGCAAA TGG Intergenic
No off target data available for this crispr