ID: 1042003227

View in Genome Browser
Species Human (GRCh38)
Location 8:64150212-64150234
Sequence CCACCTTGGAAGTAGAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042003222_1042003227 4 Left 1042003222 8:64150185-64150207 CCATGTGAGGAAACAATATTCCA No data
Right 1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG No data
1042003221_1042003227 11 Left 1042003221 8:64150178-64150200 CCATCTGCCATGTGAGGAAACAA No data
Right 1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG No data
1042003217_1042003227 22 Left 1042003217 8:64150167-64150189 CCCTTTTTTGCCCATCTGCCATG No data
Right 1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG No data
1042003220_1042003227 12 Left 1042003220 8:64150177-64150199 CCCATCTGCCATGTGAGGAAACA No data
Right 1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG No data
1042003218_1042003227 21 Left 1042003218 8:64150168-64150190 CCTTTTTTGCCCATCTGCCATGT No data
Right 1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042003227 Original CRISPR CCACCTTGGAAGTAGAGCCT GGG Intergenic
No off target data available for this crispr