ID: 1042007814

View in Genome Browser
Species Human (GRCh38)
Location 8:64201860-64201882
Sequence TGCATTTAAGGATGCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042007812_1042007814 -2 Left 1042007812 8:64201839-64201861 CCATACTTTTGGACATGACTATG No data
Right 1042007814 8:64201860-64201882 TGCATTTAAGGATGCCTGTCTGG No data
1042007811_1042007814 1 Left 1042007811 8:64201836-64201858 CCTCCATACTTTTGGACATGACT No data
Right 1042007814 8:64201860-64201882 TGCATTTAAGGATGCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042007814 Original CRISPR TGCATTTAAGGATGCCTGTC TGG Intergenic
No off target data available for this crispr