ID: 1042007817

View in Genome Browser
Species Human (GRCh38)
Location 8:64201894-64201916
Sequence GCCACCTGGACCACCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042007815_1042007817 -3 Left 1042007815 8:64201874-64201896 CCTGTCTGGAAGTTGCTGCAGCC No data
Right 1042007817 8:64201894-64201916 GCCACCTGGACCACCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042007817 Original CRISPR GCCACCTGGACCACCATGAA TGG Intergenic
No off target data available for this crispr