ID: 1042012372

View in Genome Browser
Species Human (GRCh38)
Location 8:64261681-64261703
Sequence ATGCATTTTTATAAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042012371_1042012372 -7 Left 1042012371 8:64261665-64261687 CCATTTAGCATAAAGAATGCATT No data
Right 1042012372 8:64261681-64261703 ATGCATTTTTATAAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042012372 Original CRISPR ATGCATTTTTATAAGCAAGA AGG Intergenic
No off target data available for this crispr