ID: 1042012996

View in Genome Browser
Species Human (GRCh38)
Location 8:64270472-64270494
Sequence TCATTCCAATACATAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042012993_1042012996 -6 Left 1042012993 8:64270455-64270477 CCGGGCTTGCAGGTTTGTCATTC No data
Right 1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG No data
1042012989_1042012996 29 Left 1042012989 8:64270420-64270442 CCATGTGTAAGCAGCTGCTGCAA No data
Right 1042012996 8:64270472-64270494 TCATTCCAATACATAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042012996 Original CRISPR TCATTCCAATACATAGAGAG GGG Intergenic
No off target data available for this crispr