ID: 1042028390

View in Genome Browser
Species Human (GRCh38)
Location 8:64447869-64447891
Sequence GGACGCACCATGTGACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042028390_1042028396 22 Left 1042028390 8:64447869-64447891 CCTTACTGTCACATGGTGCGTCC No data
Right 1042028396 8:64447914-64447936 TGAACGCCACTTTCTCTGGGTGG No data
1042028390_1042028395 19 Left 1042028390 8:64447869-64447891 CCTTACTGTCACATGGTGCGTCC No data
Right 1042028395 8:64447911-64447933 ATTTGAACGCCACTTTCTCTGGG No data
1042028390_1042028394 18 Left 1042028390 8:64447869-64447891 CCTTACTGTCACATGGTGCGTCC No data
Right 1042028394 8:64447910-64447932 AATTTGAACGCCACTTTCTCTGG No data
1042028390_1042028391 -9 Left 1042028390 8:64447869-64447891 CCTTACTGTCACATGGTGCGTCC No data
Right 1042028391 8:64447883-64447905 GGTGCGTCCTTTTTGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042028390 Original CRISPR GGACGCACCATGTGACAGTA AGG (reversed) Intergenic
No off target data available for this crispr