ID: 1042032079

View in Genome Browser
Species Human (GRCh38)
Location 8:64487246-64487268
Sequence TCTTCTTCCTGACATGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042032079_1042032082 30 Left 1042032079 8:64487246-64487268 CCCAGAGCATGTCAGGAAGAAGA No data
Right 1042032082 8:64487299-64487321 ATGAGCAGTGCCCTTAGAAGAGG No data
1042032079_1042032081 5 Left 1042032079 8:64487246-64487268 CCCAGAGCATGTCAGGAAGAAGA No data
Right 1042032081 8:64487274-64487296 GATTACACAGATTATCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042032079 Original CRISPR TCTTCTTCCTGACATGCTCT GGG (reversed) Intergenic
No off target data available for this crispr