ID: 1042036300

View in Genome Browser
Species Human (GRCh38)
Location 8:64538162-64538184
Sequence TATTAGGTAAAGAAAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042036300_1042036304 10 Left 1042036300 8:64538162-64538184 CCCCTCTCTTTCTTTACCTAATA No data
Right 1042036304 8:64538195-64538217 AATAAACCCTCTCTGACCAGTGG No data
1042036300_1042036307 24 Left 1042036300 8:64538162-64538184 CCCCTCTCTTTCTTTACCTAATA No data
Right 1042036307 8:64538209-64538231 GACCAGTGGCTACTGCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042036300 Original CRISPR TATTAGGTAAAGAAAGAGAG GGG (reversed) Intergenic
No off target data available for this crispr