ID: 1042037953

View in Genome Browser
Species Human (GRCh38)
Location 8:64557646-64557668
Sequence CTCAAACACAAGGCCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042037947_1042037953 10 Left 1042037947 8:64557613-64557635 CCTTGCCTTAAAGGCAGAAAGGC No data
Right 1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG No data
1042037948_1042037953 5 Left 1042037948 8:64557618-64557640 CCTTAAAGGCAGAAAGGCACTTC No data
Right 1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042037953 Original CRISPR CTCAAACACAAGGCCAGAAA AGG Intergenic
No off target data available for this crispr