ID: 1042039946

View in Genome Browser
Species Human (GRCh38)
Location 8:64580371-64580393
Sequence GACTCCCCCGTCTGTGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042039943_1042039946 2 Left 1042039943 8:64580346-64580368 CCTACTCAGAGATAATGATGTAA 0: 1
1: 0
2: 0
3: 12
4: 212
Right 1042039946 8:64580371-64580393 GACTCCCCCGTCTGTGGCGGCGG 0: 1
1: 0
2: 1
3: 6
4: 79
1042039942_1042039946 29 Left 1042039942 8:64580319-64580341 CCAACAGGCGAGTCTTCTTCATA 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1042039946 8:64580371-64580393 GACTCCCCCGTCTGTGGCGGCGG 0: 1
1: 0
2: 1
3: 6
4: 79
1042039941_1042039946 30 Left 1042039941 8:64580318-64580340 CCCAACAGGCGAGTCTTCTTCAT 0: 1
1: 0
2: 0
3: 17
4: 120
Right 1042039946 8:64580371-64580393 GACTCCCCCGTCTGTGGCGGCGG 0: 1
1: 0
2: 1
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042039946 Original CRISPR GACTCCCCCGTCTGTGGCGG CGG Exonic
901871277 1:12140526-12140548 TACTCCCCAGGCTGTGGGGGTGG - Intronic
901919485 1:12526039-12526061 GCCTCACCCAGCTGTGGCGGGGG + Intergenic
905210338 1:36369733-36369755 GACTCCCCCATCTCAGGCTGTGG + Intronic
908806871 1:67940787-67940809 GACTCCACCGACTTTGGGGGTGG - Intergenic
912174680 1:107141224-107141246 GAATCCCCGGGCTGCGGCGGTGG + Intronic
913419614 1:118650603-118650625 GACTCCCCAGTCTGTCGTTGGGG + Intergenic
919051561 1:192517784-192517806 GACTCCCCCGGCTGTAGCAGAGG + Intergenic
1075424326 10:122329629-122329651 GGCTCCCCCGGCAGTGGCTGGGG - Intronic
1076637628 10:131892502-131892524 GACTCCACCGTCCATGGCGTGGG - Intergenic
1079335080 11:19564142-19564164 GCCTACCCATTCTGTGGCGGGGG + Intronic
1083768204 11:64852401-64852423 CACTCATCCGTCTGTGGCTGAGG + Exonic
1092537497 12:9403254-9403276 GCCTCCCCCACCTGTGACGGGGG - Intergenic
1092557329 12:9570521-9570543 GCCTCCCCCACCTGTGACGGGGG + Intergenic
1095909807 12:47414703-47414725 GACACCCTCTTCTGTGGTGGGGG + Intergenic
1098426063 12:70366542-70366564 GACGCCCCCGGCGGCGGCGGCGG - Exonic
1103005616 12:117417978-117418000 AACTCCCTGGTCTGTGGCAGGGG + Intronic
1103770737 12:123321737-123321759 GACTCTCTTGTTTGTGGCGGAGG - Intronic
1106269321 13:28138586-28138608 TCCTCCCCCGTCTATGGTGGTGG + Exonic
1112308035 13:98293052-98293074 AAGTCCCCCGTTTGTGTCGGTGG + Intronic
1113857197 13:113453761-113453783 CACTTCCCCGTGTGTGGCGTGGG + Intergenic
1121174347 14:91879557-91879579 GGCCACCCCGTCTGTGGCTGGGG - Intronic
1122984031 14:105203979-105204001 CACTCCCCACTCTGTGGCCGAGG + Intergenic
1125470741 15:40001069-40001091 GACTCCTCCATCTGGGGTGGGGG - Exonic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1134551615 16:15141367-15141389 GGCTCCACCGTCCGTGGCTGGGG - Intergenic
1136556473 16:31010452-31010474 GTCTCCCGCCTCTGTGCCGGAGG + Exonic
1142595481 17:1027714-1027736 TAGTCCCCTGTCTGTGGCTGAGG + Intronic
1142678536 17:1531244-1531266 GACTCCCCTGTCTCTTGCTGTGG - Intronic
1143167323 17:4903309-4903331 GACGCCCACATCTGTGGCTGGGG - Intergenic
1143451903 17:7041749-7041771 AGCTCCCCCGTCTCTGGGGGAGG + Exonic
1144909908 17:18672505-18672527 GCCGCCCCCGGCTGCGGCGGTGG + Intronic
1144967723 17:19088758-19088780 GACTCCTCCGTCAGCGGAGGAGG + Intergenic
1144980193 17:19163305-19163327 GACTCCTCCGTCAGCGGAGGAGG - Intergenic
1144988029 17:19214927-19214949 GACTCCTCCGTCAGCGGAGGAGG + Intergenic
1151714168 17:75823063-75823085 GACTCTCCCCTCTGTGGCCAGGG - Intronic
1152019155 17:77771492-77771514 GACTCCCAGGTCTGTTGCGAGGG + Intergenic
1152183749 17:78841164-78841186 GAGTCCCCGTTCTGGGGCGGGGG - Intronic
1152278794 17:79373170-79373192 GACTCCCCCAGCTGTGGCCCAGG + Intronic
1152550739 17:81028707-81028729 CCCTCCCCCGTCTGTGGCTGCGG - Intergenic
1152561134 17:81079326-81079348 GACCGCCCCGTCTGAGGTGGAGG + Intronic
1160138520 18:76296622-76296644 CCCTCCCCCCTCTCTGGCGGCGG - Intergenic
1160724074 19:609984-610006 GCCGCCCCTGTGTGTGGCGGAGG + Intronic
1160810262 19:1010233-1010255 GACTGCCCAGCCTGTGTCGGGGG - Exonic
1161277795 19:3428600-3428622 GACTCCTCCGTCTGTGACCCGGG + Intronic
1162781223 19:13007888-13007910 CACTCCCCCCTCTGTGGCAGGGG + Intronic
1165131570 19:33635563-33635585 GCCTCCCTCCTCTGTGGAGGAGG - Intronic
1167471211 19:49677422-49677444 GGCGCCCCCGTGTGCGGCGGGGG - Intronic
927542588 2:23926588-23926610 GCTTCCCCCGGCTTTGGCGGCGG + Exonic
928984599 2:37168518-37168540 GACTCCACCATCTGTGGTGTGGG + Intronic
932074859 2:68653376-68653398 GACTGCCCAGGCTGTGGGGGAGG + Intronic
932605618 2:73163449-73163471 GATTCCACCCTCTGTGGAGGTGG - Intergenic
934843406 2:97645942-97645964 CACTCCCAAGACTGTGGCGGGGG - Intergenic
938478169 2:131634830-131634852 GACTCGGCCTTCTGTGGCTGTGG + Intergenic
938483760 2:131682591-131682613 GTCTCCGCGGTCAGTGGCGGGGG + Intergenic
946592792 2:221269849-221269871 CACTCCACCGTCTGTGGCGGTGG - Intergenic
948200888 2:236129017-236129039 GAAACCCCCGTCTGAGGCAGCGG - Exonic
1170597899 20:17819240-17819262 GACTCCTCAGTCTGTGGGGAGGG + Intergenic
1175826891 20:61941292-61941314 GACTCCTCCCCCTGTGGTGGGGG + Intergenic
1176286893 21:5023137-5023159 GAATCCCACGTGTGTGGGGGAGG - Intronic
1179870288 21:44240338-44240360 GAATCCCACGTGTGTGGGGGAGG + Intronic
1180934183 22:19613370-19613392 GGCTCCCACGCCTGTGGTGGGGG - Intergenic
1183428162 22:37750675-37750697 GGGTCCCCCGACTGTGGCTGTGG + Intronic
962985386 3:140531486-140531508 GACTCTGCCATCTGTGGCAGAGG - Intronic
968753005 4:2399955-2399977 GGCTCCCCTGTCTGAGGAGGAGG - Intronic
969398689 4:6939361-6939383 GACTCCCAGCTCTGTGGCTGGGG + Intronic
970355368 4:15245696-15245718 GACTCTGCTGTCTGTGGTGGGGG + Intergenic
970891301 4:21047946-21047968 AACTCCCCCATATGTGGAGGGGG + Intronic
973760191 4:54108483-54108505 GGCTCCCCCGTCGGTGGCGCCGG + Intronic
984490762 4:180431754-180431776 AACTACCTCCTCTGTGGCGGGGG + Intergenic
990346906 5:54880466-54880488 GACTCCCATGCCTGTGGCTGGGG - Intergenic
1004413166 6:15400460-15400482 GAGTCCGCTGTCTGTGGGGGTGG + Intronic
1012193847 6:96315374-96315396 GACACCCACATCTGTGGCAGGGG - Intergenic
1013273406 6:108561608-108561630 GCCGCCCCCGGCTGCGGCGGTGG - Exonic
1015757320 6:136620581-136620603 GACTCCACGTTCTGTGGCCGTGG - Intronic
1020260509 7:6528347-6528369 GACTCTCCGGTCTGTGGCAGAGG + Intronic
1026559109 7:71433343-71433365 GTCACCCCCATCTGTGGAGGAGG + Intronic
1042039946 8:64580371-64580393 GACTCCCCCGTCTGTGGCGGCGG + Exonic
1057695251 9:97318490-97318512 TACTCCCCCGGCTGTGACGAAGG + Exonic
1061040440 9:128138466-128138488 GACTCCCCCGCCTGTGATGGGGG + Intergenic
1061253013 9:129437564-129437586 GACACCCCTGACTCTGGCGGGGG - Intergenic
1062084690 9:134642495-134642517 GACCCGCCCGTCTGGGGAGGGGG - Intronic
1203771642 EBV:52733-52755 AACTTCCCGGTCTGTGGCCGGGG + Intergenic
1197838084 X:130716455-130716477 GATCCCCCCATCTGTGGTGGAGG + Intronic
1199872699 X:151913070-151913092 GACTTCTCAGTCTGTGGTGGGGG + Intronic
1199896908 X:152135512-152135534 GGCTCCCCTGGCTGTGGAGGAGG - Exonic