ID: 1042040675

View in Genome Browser
Species Human (GRCh38)
Location 8:64585670-64585692
Sequence CTGGCACATGCTGCAGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042040675_1042040678 -5 Left 1042040675 8:64585670-64585692 CCTAAGACTGCAGCATGTGCCAG No data
Right 1042040678 8:64585688-64585710 GCCAGAGTGCAAGGGTATCTTGG No data
1042040675_1042040680 16 Left 1042040675 8:64585670-64585692 CCTAAGACTGCAGCATGTGCCAG No data
Right 1042040680 8:64585709-64585731 GGCCACCCCTGAGCTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042040675 Original CRISPR CTGGCACATGCTGCAGTCTT AGG (reversed) Intergenic
No off target data available for this crispr