ID: 1042041388

View in Genome Browser
Species Human (GRCh38)
Location 8:64594245-64594267
Sequence CTGCTGACAGTGTCCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042041384_1042041388 -1 Left 1042041384 8:64594223-64594245 CCTCTGTCCCACAATAACTGTCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1042041388 8:64594245-64594267 CTGCTGACAGTGTCCATCACTGG No data
1042041386_1042041388 -9 Left 1042041386 8:64594231-64594253 CCACAATAACTGTCCTGCTGACA 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1042041388 8:64594245-64594267 CTGCTGACAGTGTCCATCACTGG No data
1042041385_1042041388 -8 Left 1042041385 8:64594230-64594252 CCCACAATAACTGTCCTGCTGAC 0: 1
1: 0
2: 4
3: 5
4: 106
Right 1042041388 8:64594245-64594267 CTGCTGACAGTGTCCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042041388 Original CRISPR CTGCTGACAGTGTCCATCAC TGG Intronic
No off target data available for this crispr