ID: 1042042223

View in Genome Browser
Species Human (GRCh38)
Location 8:64604712-64604734
Sequence ATGTAGGACTGGAGGAAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042042216_1042042223 8 Left 1042042216 8:64604681-64604703 CCTCTGGAGCTTCAAAGATTTCA 0: 1
1: 0
2: 0
3: 20
4: 165
Right 1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG 0: 1
1: 0
2: 0
3: 37
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042042223 Original CRISPR ATGTAGGACTGGAGGAAAGA TGG Exonic
900993146 1:6107036-6107058 ATGGAGGGATGGAGGAATGATGG + Intronic
900993427 1:6108131-6108153 ATGGAGGGATGGAGGAATGATGG + Intronic
901249096 1:7759422-7759444 AGGTAGGCCTGAAGGAAAGGGGG - Intronic
902375206 1:16027199-16027221 CTGTAGGACAGCAGGACAGATGG + Intronic
903682872 1:25108774-25108796 AGGAAGGACGGAAGGAAAGATGG + Intergenic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
906226676 1:44128521-44128543 ATCAAGCACTGGAGGAGAGATGG - Intronic
906542637 1:46599597-46599619 AGGTTAGACTGGAGCAAAGATGG - Intronic
906794965 1:48689468-48689490 AAGGAGGAAGGGAGGAAAGAAGG - Intronic
907238023 1:53064591-53064613 AGGTAGGACTAGAAGAAGGAAGG - Intronic
907907750 1:58799774-58799796 AGGAAGGACAGGAGGAAGGAAGG - Intergenic
908218697 1:61981593-61981615 AAGTATGACTGGAGGACAAAAGG + Intronic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
908841460 1:68284276-68284298 AAGTATGACTGGAGGACAAAAGG - Intergenic
908843429 1:68300795-68300817 AGGAAGGAATGGAGGAAAGAAGG - Intergenic
909101479 1:71354610-71354632 ATGAAAGACAGAAGGAAAGAAGG - Intergenic
909526910 1:76635171-76635193 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
909692123 1:78420906-78420928 AGGTAGGAAGGAAGGAAAGAAGG - Intronic
909692127 1:78420926-78420948 AGGTAGGAAGGAAGGAAAGAAGG - Intronic
909892311 1:81022862-81022884 ATTTAGGAATGAAGGAAAGGAGG - Intergenic
909916992 1:81332743-81332765 ATGTATTACTGGAGAAAATAAGG - Intronic
910118341 1:83757325-83757347 AGGTAGGACTGGGGAAAAGAGGG - Intergenic
910396964 1:86803259-86803281 CTTTAGGACAGGAGGATAGATGG - Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
911143999 1:94535117-94535139 AGGTAGGAATGGTGAAAAGAAGG - Intronic
912228793 1:107768028-107768050 GTGGAGGAATGGAGGAAAGTAGG + Intronic
912404905 1:109428978-109429000 ATCTAGGGCTGGAGGAAAAGGGG + Intergenic
912752668 1:112298639-112298661 AAGGAGGTATGGAGGAAAGAAGG + Intergenic
913491615 1:119385107-119385129 ATGGAGGAAAGGAGAAAAGAGGG - Intronic
914991381 1:152502224-152502246 ATGCAGGAGTGGAGGAAAAAGGG + Intergenic
915357716 1:155265947-155265969 ATGGAGGACTGTAGGGGAGAAGG + Exonic
916228453 1:162514596-162514618 TTGTAGGAAGGAAGGAAAGAAGG + Intronic
916251561 1:162743242-162743264 ATGAAGAACTGAAGGCAAGAGGG - Intronic
916779534 1:168009514-168009536 AAGAAGGGATGGAGGAAAGAAGG - Intronic
918553727 1:185774366-185774388 ATCTACTACAGGAGGAAAGATGG + Intronic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919253734 1:195095592-195095614 ATGTAGGACAGTTGGAAATAGGG + Intergenic
919983320 1:202656094-202656116 ATGCAGCACTGGGGGAAAGCGGG + Intronic
920742369 1:208593470-208593492 GGGCAGGAGTGGAGGAAAGAGGG + Intergenic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921614536 1:217250926-217250948 AGGTTGGGCTGGAGTAAAGATGG - Intergenic
921726131 1:218525605-218525627 ATATAGCCCTGGAGGACAGAGGG - Intergenic
922004911 1:221520483-221520505 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
923185046 1:231563608-231563630 ATCTGAGACTGGAGGATAGAAGG + Intronic
923784466 1:237054196-237054218 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
924188977 1:241528846-241528868 ATGAAGGAAGGAAGGAAAGAAGG + Intergenic
1063937403 10:11092567-11092589 AAATATGATTGGAGGAAAGAAGG + Intronic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064493514 10:15884715-15884737 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
1064778848 10:18810768-18810790 ATGGAGGAATGGAGGAAGGGAGG - Intergenic
1064778851 10:18810776-18810798 ATGGAGGAATGGAGGAATGGAGG - Intergenic
1065302353 10:24334391-24334413 ATGAAGGAAGGAAGGAAAGATGG + Intronic
1065410409 10:25420828-25420850 ATGTAGTACTGGCATAAAGAGGG - Intronic
1065861975 10:29879463-29879485 AGGTAGGACAGGAGACAAGATGG + Intergenic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1066105934 10:32157032-32157054 GTGTAGAATTGGAGGAATGAGGG + Intergenic
1067163017 10:43842954-43842976 AGGAATGAATGGAGGAAAGAAGG + Intergenic
1067377991 10:45745563-45745585 TTGGAGGACTGGAAGAAAGGCGG - Intronic
1067463182 10:46473508-46473530 AAATAGAACTGGGGGAAAGAAGG + Intergenic
1067624011 10:47911130-47911152 AAATAGAACTGGGGGAAAGAAGG - Intergenic
1067885689 10:50086239-50086261 TTGGAGGACTGGAAGAAAGGCGG - Intronic
1068655704 10:59573946-59573968 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1069124275 10:64609767-64609789 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
1070889929 10:79935732-79935754 ATGTAGGAGTGTCGGGAAGAGGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071713120 10:88069128-88069150 ATGTAGGGCATGAGGAATGAAGG - Intergenic
1071767388 10:88683158-88683180 AAGCAGGAATGGAGGCAAGAAGG + Intergenic
1071827087 10:89336119-89336141 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1071827107 10:89336180-89336202 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1072333520 10:94376602-94376624 AAGAAGGAAGGGAGGAAAGAAGG - Intergenic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072759434 10:98043714-98043736 AGGAAGGTCTGGAGGAAAGGAGG + Intergenic
1073359487 10:102886264-102886286 AGGAAGGAATGAAGGAAAGAAGG - Intronic
1073522586 10:104147778-104147800 ATGTAGGAATGGTGCAAGGAAGG + Intronic
1073615137 10:104987176-104987198 ATGAAGGACGGAACGAAAGAAGG + Intronic
1073988817 10:109240579-109240601 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1074447864 10:113535034-113535056 ATGAAAGACTGGTGGACAGAAGG - Intergenic
1075065667 10:119287390-119287412 AAGAAGGAAGGGAGGAAAGAAGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075174051 10:120143129-120143151 AGGTAGAACTGGAGGACAAATGG - Intergenic
1075283037 10:121157584-121157606 ATGGAGGAAGGGTGGAAAGAGGG + Intergenic
1076054956 10:127364831-127364853 AAGAAGGAAGGGAGGAAAGAAGG - Intronic
1077497164 11:2891938-2891960 AGGAAGGAATGAAGGAAAGAAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077903981 11:6514512-6514534 AGGGAGGAAGGGAGGAAAGAAGG - Intronic
1078566171 11:12416303-12416325 AGGTGGAACTGGATGAAAGATGG - Intronic
1079453372 11:20616867-20616889 CTGTAGGACTGTAGGAATGATGG - Intronic
1079470621 11:20774141-20774163 AGGGAGGGATGGAGGAAAGAAGG - Intronic
1079629234 11:22653096-22653118 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
1080170946 11:29302029-29302051 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1081263008 11:40984194-40984216 AGGTAGGAAGGAAGGAAAGAAGG + Intronic
1082795461 11:57375756-57375778 AGGTAGGCCAGGAGGAAGGAAGG + Intergenic
1082887989 11:58108669-58108691 ATGAAGACCTGGAGAAAAGATGG + Intronic
1083042734 11:59703312-59703334 ATGGAGCAGTGGAGGAAAGTGGG - Intergenic
1083259954 11:61517521-61517543 ATGGAGGGGTGGAGGAAAGAAGG + Intronic
1083738085 11:64693167-64693189 AGGCAGAACTGGAGGAAGGAGGG + Intronic
1084667819 11:70585921-70585943 ATGGAGGAATGGATGAAGGATGG - Intronic
1085214666 11:74818287-74818309 AAGAAGAAATGGAGGAAAGAAGG + Intronic
1085694782 11:78694827-78694849 ATTCGGCACTGGAGGAAAGAAGG - Intronic
1085982922 11:81746021-81746043 ATGTAAGAAGGGATGAAAGAAGG + Intergenic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086244561 11:84736236-84736258 ATATAGTATTGGTGGAAAGATGG - Intronic
1087630593 11:100646483-100646505 AGGTAGGAAGGAAGGAAAGAAGG + Intergenic
1088544886 11:110949155-110949177 ATGGAGGAAAGAAGGAAAGAGGG - Intergenic
1089072514 11:115711351-115711373 CTGTATGACTGGAGGAGAGCAGG - Intergenic
1090462122 11:126900886-126900908 ATGTAAAACTGTAGGAAAAAAGG + Intronic
1091001947 11:131917214-131917236 ATGAATGACTGCAGGAATGAAGG + Intronic
1092115567 12:6000039-6000061 ATGTAAGACAGGAGAAAAAATGG + Intronic
1092910340 12:13140312-13140334 ATGTAGGACTGGATGAGGGTTGG - Intronic
1093972093 12:25384911-25384933 ATGTAGGAGTGAGGGAACGACGG + Intergenic
1096001437 12:48133874-48133896 ATGTAGGATGGGAGGATAGAAGG + Intronic
1096093512 12:48919039-48919061 ATGTAAGAGGGGAGGAAACATGG - Intronic
1096556796 12:52408852-52408874 ATATAGGACAGGAGGAGAAAGGG + Intergenic
1096594620 12:52686833-52686855 ATGGAGGCCTGGGGGACAGATGG - Intergenic
1097319177 12:58206750-58206772 ATTCAGAACTGTAGGAAAGAAGG - Intergenic
1097640227 12:62172234-62172256 ATGAAGGAAGGGAGGAAGGAAGG - Intronic
1098444240 12:70550087-70550109 ATGTAGGATTAGAGGAATGTAGG + Intronic
1098523534 12:71460749-71460771 ATGTAGGAGAGGAGGAAGAATGG - Intronic
1098907992 12:76181064-76181086 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
1098967995 12:76814272-76814294 AAGTAGTAGTGGGGGAAAGATGG + Intronic
1099020605 12:77399463-77399485 AGGTAAGAATGGAGGAAACAGGG - Intergenic
1099842251 12:87980887-87980909 ATGGACTACTGGAGGAAAGGAGG - Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101261653 12:103038103-103038125 AGGGAGGACAGGAGGAAAGAAGG + Intergenic
1101925180 12:108965946-108965968 ATGGAGGGAGGGAGGAAAGAAGG - Intronic
1101952637 12:109188409-109188431 AGGAAGGACGGGAGGAAGGAAGG - Intronic
1101952649 12:109188442-109188464 AGGGAGGAAGGGAGGAAAGAAGG - Intronic
1102552560 12:113702263-113702285 AGGAAGGAAGGGAGGAAAGATGG - Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1103040542 12:117691617-117691639 ATGGAGAACTGGAGGCAGGAGGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105662159 13:22508434-22508456 TTCAAGGACTGGAGGAAAAATGG - Intergenic
1105699972 13:22928212-22928234 ATGTAGGGCTGGAGAATTGATGG + Intergenic
1106288060 13:28335388-28335410 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
1106756826 13:32830060-32830082 AAGTAAGACTTGTGGAAAGAGGG - Intergenic
1106793182 13:33177702-33177724 ATGGAGGAAGGGAGGAAGGAGGG + Intronic
1107754784 13:43608715-43608737 ATATAGGATGGGAGGAAAAAGGG - Intronic
1107883856 13:44857718-44857740 ATGTAGGAGGGAAGGAAGGAGGG - Intergenic
1108149397 13:47516943-47516965 ATGCAGGACTGGAGGAGTGGCGG - Intergenic
1109624861 13:64961893-64961915 ATTTAGGAAAGGAGGGAAGATGG + Intergenic
1110325775 13:74213630-74213652 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1110394458 13:75013178-75013200 AGGTAGGAATGAAGGAAGGAAGG - Intergenic
1110823160 13:79939989-79940011 ATGTGGGAGTGAAGAAAAGAAGG + Intergenic
1110975296 13:81825707-81825729 ATGTAGAACTGTGTGAAAGAAGG - Intergenic
1111086366 13:83380519-83380541 AGGAAGGACAGAAGGAAAGAAGG - Intergenic
1111086383 13:83380573-83380595 AGGAAGGACAGAAGGAAAGAAGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111278288 13:85982488-85982510 GTGGAGTACTGAAGGAAAGAAGG - Intergenic
1111452609 13:88438713-88438735 AGGGAGGAAGGGAGGAAAGATGG + Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113232628 13:108231395-108231417 ATGTAGGAGTGTGGGAATGAAGG + Exonic
1113234857 13:108261333-108261355 AGGGAGGACGGGAGGAAGGAAGG - Intronic
1113458737 13:110467169-110467191 ATGCAGGACCAGAGGAAAGATGG - Intronic
1114759518 14:25297543-25297565 GTGTAGGCCAGGATGAAAGAAGG - Intergenic
1114798503 14:25743723-25743745 ATGAAGGAAAGAAGGAAAGAAGG - Intergenic
1114841652 14:26269862-26269884 ATGTAGGATTGGTGGAGGGATGG - Intergenic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1115020149 14:28669992-28670014 AGGGAGGAGTGGAGGAAGGAAGG + Intergenic
1115342516 14:32307676-32307698 ATGGAGAACTGAAGGAAAAAGGG + Intergenic
1115936811 14:38561440-38561462 ATCTGGGACTGGAGCAAAAAAGG + Intergenic
1116098448 14:40403494-40403516 TTGTATGACTGGAGGAGTGATGG - Intergenic
1116218936 14:42056778-42056800 ATGAAGGAATGAAGGAAGGAAGG + Intergenic
1116972041 14:51076351-51076373 ATGGAGGAATGGAGGAAAGGAGG - Intronic
1117247438 14:53900160-53900182 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1117513922 14:56481535-56481557 ATGGAGGAAGGAAGGAAAGAAGG + Intergenic
1117767380 14:59097116-59097138 ATGAATGAAAGGAGGAAAGAAGG - Intergenic
1117918289 14:60701621-60701643 AAGAAGGAAGGGAGGAAAGAAGG - Intergenic
1118112898 14:62742716-62742738 ATGAAGGACTGCAGGCAACATGG + Intronic
1118291936 14:64534802-64534824 ATGTTGGCCTGAAGAAAAGATGG - Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1118988888 14:70780262-70780284 TTGTTGGGCTGGAGGATAGAAGG + Intronic
1118991899 14:70804608-70804630 GCTTAAGACTGGAGGAAAGAAGG - Intronic
1120530038 14:85621308-85621330 ATGGAGGACAGCAGCAAAGAGGG + Exonic
1120764448 14:88315906-88315928 AAGAAGGACGGGAGGAATGAAGG + Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1122040412 14:98983849-98983871 AAGAAGGAATGAAGGAAAGAAGG + Intergenic
1122050320 14:99054855-99054877 ATGTTGGAGTGAAGAAAAGATGG + Intergenic
1122061106 14:99137247-99137269 CTGTAGCCCAGGAGGAAAGACGG - Intergenic
1124555719 15:30723935-30723957 GTGTAGGAATGGAGCAATGAAGG + Intronic
1125149214 15:36512112-36512134 ATGAAGGAAGGGAGGAGAGAAGG + Intergenic
1126671614 15:51120631-51120653 AAGTATGATTGGAGGACAGAAGG + Intergenic
1126991947 15:54388199-54388221 ATTTTGGTCTGGAGGAAGGAAGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127788640 15:62378717-62378739 ATGGAGGAAGGAAGGAAAGAAGG + Intergenic
1127851217 15:62913553-62913575 ATGAAGGTATGGAGGAGAGATGG + Intergenic
1127889828 15:63240017-63240039 ATGCAGGAGTGCAGGAAAGGAGG + Intronic
1128200796 15:65805405-65805427 ATGTAGGAATGGAGAAAATGTGG - Intronic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1130123547 15:81073010-81073032 ATGAAGGAATGAAGGAAGGAAGG - Intronic
1130373666 15:83309079-83309101 AGGTAGGAAGGAAGGAAAGAAGG - Intergenic
1131793316 15:95988340-95988362 AAGTAGGAAGGGAGGAAGGAAGG + Intergenic
1132064887 15:98722678-98722700 AGGTAGGAGTGGTGGAAAGCTGG + Intronic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133431624 16:5742187-5742209 AGGAAGGACTGGAGGAAGGAAGG - Intergenic
1133495381 16:6312704-6312726 AGGAAGGAATGGAGGAAGGAAGG - Intronic
1133647138 16:7775098-7775120 ACGAAGGAATGAAGGAAAGAAGG + Intergenic
1134130741 16:11648209-11648231 ATGAAGGAATGAAGGAAGGAAGG + Intergenic
1134258023 16:12627315-12627337 ATGTAAGACTTGAGTACAGAGGG - Intergenic
1134334936 16:13289589-13289611 ATGAAGGAGGGTAGGAAAGAAGG + Intergenic
1134410082 16:13996479-13996501 ATGGATGAATGGAAGAAAGAAGG - Intergenic
1134417408 16:14056315-14056337 AGGAAGGAAAGGAGGAAAGAAGG - Intergenic
1136179225 16:28539338-28539360 ATGCAGGACGTGAGGAAGGAGGG + Intergenic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1137919664 16:52474650-52474672 ATGAAGGAAAGGAAGAAAGAAGG + Intronic
1138150867 16:54655545-54655567 ATGGAGGAGTGGAGGCGAGAGGG - Intergenic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138770852 16:59661825-59661847 ATGTATGAATGTAGGACAGAAGG + Intergenic
1139662346 16:68429731-68429753 ATGAAGGACTTGAGGACAAAGGG + Intronic
1140603488 16:76506395-76506417 AGGGAGGAAGGGAGGAAAGAAGG - Intronic
1140894964 16:79316845-79316867 ATGCTGGACTGAAAGAAAGAGGG + Intergenic
1141024925 16:80537484-80537506 ATGCAGGGAAGGAGGAAAGATGG + Intergenic
1141177073 16:81728107-81728129 ATGGAGGAAGGAAGGAAAGAAGG - Intergenic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1141569445 16:84925412-84925434 ATATTGGACTGGAAGGAAGAGGG - Intergenic
1142096933 16:88245126-88245148 ATGAGGGAGGGGAGGAAAGAAGG + Intergenic
1142153357 16:88522329-88522351 AGGGTGGGCTGGAGGAAAGACGG + Intronic
1143647024 17:8237268-8237290 ATGTAGGAAAGGAGGACAGCTGG - Intronic
1143701087 17:8660788-8660810 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1143714018 17:8754165-8754187 ATGAATGAATGAAGGAAAGAAGG + Intronic
1145037819 17:19553445-19553467 ATGTGGGAGGGAAGGAAAGATGG - Intronic
1145061232 17:19735558-19735580 AAGCAAGAGTGGAGGAAAGAAGG + Intergenic
1146076749 17:29737328-29737350 ATGGAGGACAGAAGGAAAGCTGG - Intronic
1146424047 17:32719053-32719075 ATGTGGAACAGGAGTAAAGATGG - Intronic
1146619300 17:34385171-34385193 AGGTAGGAAGGAAGGAAAGAAGG - Intergenic
1151100489 17:71550761-71550783 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1151377939 17:73704190-73704212 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1151531124 17:74705487-74705509 ATGTAGGATTGGCAGAAAGGTGG - Intronic
1152358219 17:79816712-79816734 ATGGAGGCCTGGAGGAATGAAGG - Intergenic
1153113016 18:1616522-1616544 ATGCAGTAATGGAGGAATGAAGG + Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1153677895 18:7471503-7471525 AAGTAGGACTGGAGTACTGAGGG + Intergenic
1153968933 18:10207057-10207079 ATGGAAGTCTGGAGGAAAGGTGG + Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1155014667 18:21821507-21821529 AGGTAGCTCTGGAAGAAAGACGG - Intronic
1155028007 18:21959854-21959876 AAGAAGGACAGAAGGAAAGAAGG + Intergenic
1155409866 18:25531998-25532020 ATGGAGGATTGGGGGAGAGATGG + Intergenic
1155710798 18:28876673-28876695 ATGTAAGAATGAAGGAAGGAAGG - Intergenic
1155724032 18:29056678-29056700 ATGTAGGAATGGAGAAAGCAGGG + Intergenic
1155748825 18:29394656-29394678 ATGAAGGAAGGAAGGAAAGAAGG + Intergenic
1156377948 18:36531509-36531531 ATTTAGGAAGGGAGGCAAGATGG - Intronic
1156991988 18:43420247-43420269 ATGGAGGAAGGAAGGAAAGAAGG - Intergenic
1157637351 18:49171697-49171719 TTGTAGGAGAGGAGGAAGGAGGG - Intronic
1158412943 18:57223639-57223661 TAGTAGGACTGGGGGAAGGAAGG + Intergenic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1158866401 18:61641740-61641762 ATGTAACACTGGAGGAAACCAGG - Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159354395 18:67318926-67318948 ATGTAGGACATGGAGAAAGATGG - Intergenic
1159356071 18:67338293-67338315 AGGAAGGAATGGAGGAAGGAAGG - Intergenic
1159356097 18:67338377-67338399 ATGAAGGAATGGAGGAAGGAAGG - Intergenic
1159418812 18:68188125-68188147 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1159507392 18:69354802-69354824 ATGTGGGAGTGGATGAAAGGAGG - Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1161130444 19:2585118-2585140 AGGTAGGAATGAAGGAAGGAAGG + Intronic
1161329201 19:3678354-3678376 ATGGAGGAATGGAGGATGGAGGG + Intronic
1161789294 19:6349431-6349453 AAGAAGGAAGGGAGGAAAGAAGG + Intergenic
1161934516 19:7363408-7363430 ATGAAGGAAGGAAGGAAAGAAGG + Intronic
1161934621 19:7364043-7364065 ATGAATGAATGAAGGAAAGATGG + Intronic
1162362050 19:10226538-10226560 CCAAAGGACTGGAGGAAAGAGGG - Intronic
1162537734 19:11273607-11273629 AAGAAGGACAGAAGGAAAGAAGG - Intergenic
1163488390 19:17602978-17603000 AGGCTGGACTGGAGGAGAGACGG + Exonic
1164230659 19:23284870-23284892 ATGTCAGTGTGGAGGAAAGAAGG + Intergenic
1164535225 19:29081071-29081093 ATGTAGGAAAGTAGGAAAGTGGG - Intergenic
1164739401 19:30565324-30565346 ATGTTGCAGAGGAGGAAAGATGG + Intronic
1164874857 19:31676856-31676878 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
1165020446 19:32920006-32920028 ATGAAGGAAGGGAGGAAGGAAGG - Intronic
1165315168 19:35050640-35050662 ATGCAGGACAGCAGGAAAAAAGG + Intronic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1165872986 19:38986357-38986379 AGGGAGGAAGGGAGGAAAGAAGG - Intergenic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1166706400 19:44910348-44910370 AGATAAGACTGGAGGAGAGAAGG - Intergenic
1167534632 19:50041850-50041872 ATGGAGGTCTGGAAGACAGAAGG - Intronic
1168330517 19:55565129-55565151 AAGAAGGAAGGGAGGAAAGAAGG + Intergenic
1168376309 19:55882881-55882903 TAGTAGGACTGGCAGAAAGAAGG - Intergenic
1168461598 19:56563916-56563938 ATTAAAAACTGGAGGAAAGAGGG - Intergenic
926176275 2:10595105-10595127 AGGTAGGACTACAGGCAAGAGGG + Intronic
926790796 2:16569407-16569429 TTCTAAGCCTGGAGGAAAGATGG - Intronic
927019161 2:18999478-18999500 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928112140 2:28519366-28519388 ATGCAGGACTGTGGGACAGAAGG + Intronic
928166127 2:28973383-28973405 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
928326192 2:30321538-30321560 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
929311506 2:40431396-40431418 ATGAAGGACTGTAGGCAAGGAGG + Intronic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
930365996 2:50440034-50440056 ATTTATGACTAGAGGAAAAAGGG + Intronic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
930715193 2:54587582-54587604 ATGGAGGACTGGAGGAGAAGAGG + Intronic
930851892 2:55970365-55970387 ATGAAGGAATGAAGGAAGGATGG + Intergenic
931385665 2:61795535-61795557 AGGGAGGAAGGGAGGAAAGAGGG + Intergenic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
931939996 2:67241521-67241543 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
932924311 2:75954283-75954305 GTGGAGGAAGGGAGGAAAGAAGG - Intergenic
932944461 2:76211289-76211311 ATGGACAAATGGAGGAAAGATGG - Intergenic
933031705 2:77336291-77336313 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
935663445 2:105489123-105489145 ATGAAGGAAGGAAGGAAAGAAGG + Intergenic
936096367 2:109533145-109533167 AGGGAGGAAGGGAGGAAAGAGGG + Intergenic
936461684 2:112718932-112718954 ATGGAGGAATGGAGGATGGATGG - Intergenic
936541089 2:113352222-113352244 ATAAAGACCTGGAGGAAAGAAGG + Intergenic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937270870 2:120651447-120651469 AGGTAGGAAGGCAGGAAAGAAGG + Intergenic
937685019 2:124686283-124686305 TTGGAGGAGTGGAGTAAAGAAGG + Intronic
938097329 2:128472121-128472143 AGGTGGGACTGGATGAATGAAGG + Intergenic
938179420 2:129166466-129166488 ATGTATGATGGGAGGAACGAAGG + Intergenic
939038145 2:137157422-137157444 ATGGGGGACTGGAGCAAAGCCGG + Intronic
939067741 2:137504975-137504997 AGGGAGGAATGGAGGAAAGCAGG + Intronic
939504594 2:143029972-143029994 ATGGAGGACAGGAGGAAATTTGG + Intronic
939761748 2:146190958-146190980 AGGTAGGAAGGAAGGAAAGAGGG + Intergenic
940750723 2:157624597-157624619 ATGTAGGATTGGAGAAAACTAGG + Intronic
941670060 2:168283557-168283579 AGGAAGGGCTGGAGGCAAGAGGG - Intergenic
942341958 2:174958153-174958175 AGGAAGGACAGGAGGAGAGAAGG + Intronic
942696182 2:178648708-178648730 ATGTAGAAATTGAGGAAATAAGG - Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499232 2:188666128-188666150 ATGAAGGAAGGGAGGAATGAGGG - Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
944424665 2:199567720-199567742 ATGCAGGATTGGGAGAAAGAGGG - Intergenic
944691694 2:202164488-202164510 TTGTATGACTCAAGGAAAGAAGG + Intronic
945397005 2:209331436-209331458 ATTTAGGTCTGGAGATAAGATGG - Intergenic
945633254 2:212311645-212311667 ATTTAGGACTTGAGGAGAGGTGG - Intronic
946565841 2:220964711-220964733 ATGGAGGAAAGGAGGAGAGACGG - Intergenic
946661112 2:222000499-222000521 ATGGAGGACTGCAGGAGAGCTGG - Intergenic
947003376 2:225484249-225484271 CTGTAGGACTGTAAGAAGGATGG + Intronic
947212544 2:227721297-227721319 ATATAGGAGTGGAGAAAAGGTGG + Intergenic
947955139 2:234183334-234183356 ATATAGGACTGGAGGGAGGCTGG - Intergenic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948161390 2:235827789-235827811 ATGTAGGCCTTGAAGATAGAGGG + Intronic
948255686 2:236566966-236566988 AGGTAGGAAGGAAGGAAAGAAGG - Intergenic
948341728 2:237258237-237258259 ATGTAGAACTGGAGTAACAAGGG + Intergenic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1170298193 20:14852474-14852496 GTTTAGTAGTGGAGGAAAGAGGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1172787773 20:37480481-37480503 AGGAAGGAATGAAGGAAAGAAGG - Intergenic
1173246493 20:41341055-41341077 ATGTAGGATGGCAGGACAGATGG - Intronic
1173854019 20:46238146-46238168 CTGAAGGACTAGAGGAAAGCAGG - Intronic
1173950064 20:46985226-46985248 TTGGAGGAAGGGAGGAAAGAAGG - Intronic
1174551948 20:51368559-51368581 ATGAAGGAATGAAGGAAGGAAGG - Intergenic
1175063405 20:56264213-56264235 TCGTAGGACTGGAGCACAGAGGG + Intergenic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176998753 21:15585983-15586005 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1177874591 21:26615634-26615656 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1177874594 21:26615654-26615676 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1178221064 21:30660774-30660796 ACTAAGGACTGGAGGAAAGTGGG + Intergenic
1178791491 21:35704533-35704555 ATGAAGGAATGAAGGAAGGAAGG + Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1180054136 21:45348513-45348535 ATGTAAGAGTGGATAAAAGAAGG + Intergenic
1180352002 22:11813432-11813454 AGGTAGGACGGAAGGAAGGAAGG + Intergenic
1180386208 22:12178638-12178660 AGGTAGGACGGAAGGAAGGAAGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181094598 22:20496525-20496547 GTGGAGGAGAGGAGGAAAGAAGG - Intronic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181495369 22:23284521-23284543 AGGTTGGAATGGAGCAAAGAGGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181907345 22:26209842-26209864 AGGAAGGAATGAAGGAAAGAAGG + Intronic
1181963266 22:26638343-26638365 AGGAAGGAGTGGAGGAAGGAGGG + Intergenic
1182025688 22:27116709-27116731 AGGTAGGAAAGGAGGAAGGATGG + Intergenic
1182361584 22:29749543-29749565 AAGTAGCATTGGAGCAAAGATGG - Intronic
1183029112 22:35088916-35088938 GTGGAGGAGTGGAGGAGAGAAGG - Intergenic
1183390681 22:37544179-37544201 AAGGAGGAAAGGAGGAAAGAAGG + Intergenic
1183714824 22:39527514-39527536 GGGTAGCACTGGAGGAGAGAGGG - Intergenic
1185215530 22:49597968-49597990 ATGGAGGACAGAAGGAATGAGGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949611352 3:5706953-5706975 CTTCAGGACTGGAGGATAGATGG - Intergenic
949619667 3:5796372-5796394 ATGAAGGAATGAAGGAAGGAAGG - Intergenic
949960654 3:9309368-9309390 ATAGAGGAAAGGAGGAAAGAGGG - Intronic
950037776 3:9899521-9899543 AAGGAGGAAGGGAGGAAAGAAGG - Intergenic
950327178 3:12121727-12121749 AGGAAGGAATGAAGGAAAGAAGG + Intronic
951103595 3:18717580-18717602 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
951186590 3:19720833-19720855 AGGAAGGACGGAAGGAAAGAAGG + Intergenic
951350182 3:21597515-21597537 ATTTTTGACTGGTGGAAAGAAGG + Intronic
953175739 3:40550533-40550555 AAGGAGGAAAGGAGGAAAGAAGG - Intronic
953434243 3:42865951-42865973 AAGTAGGAAGGGAGGAAAGGAGG - Exonic
954916295 3:54151016-54151038 ATGTAGGGATAGAGGATAGATGG + Intronic
955202439 3:56863061-56863083 AAGAAGGACTTGAAGAAAGATGG + Intronic
955855895 3:63273138-63273160 CTGTAGAACTGAAGTAAAGATGG - Intronic
956242589 3:67147149-67147171 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
956556473 3:70528789-70528811 ATGTAGGATTGGAAAAAAGATGG - Intergenic
957293829 3:78310923-78310945 AGGGAGGAAGGGAGGAAAGAAGG + Intergenic
957449644 3:80362474-80362496 AGGTAGGAAGGGAGAAAAGAAGG - Intergenic
957467089 3:80608119-80608141 AGGGAGGAAGGGAGGAAAGAAGG + Intergenic
957779762 3:84803709-84803731 ATTTAGGACAGGACAAAAGAGGG + Intergenic
958175881 3:89995970-89995992 ATGGAGGAGTGGAGCCAAGATGG + Intergenic
958504522 3:94957389-94957411 AGGGAGGAAGGGAGGAAAGAAGG - Intergenic
959416227 3:106078934-106078956 AAGAAGGAATGAAGGAAAGAAGG - Intergenic
960531262 3:118767890-118767912 ATGTAGGACTGGAGCACAAAAGG + Intergenic
960726364 3:120674314-120674336 ATGTAGGATTAGAGCAAACATGG + Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961325886 3:126109133-126109155 ATGAAGGAGGGAAGGAAAGAAGG - Intronic
961340158 3:126212410-126212432 AAGGAGGAAGGGAGGAAAGAAGG + Intergenic
962015774 3:131438873-131438895 GTTTAGGACTTGAGGAGAGAAGG + Intergenic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962841635 3:139238118-139238140 AGGTAGGAAGGAAGGAAAGAAGG - Intronic
963074603 3:141334361-141334383 ATGGAGGGAGGGAGGAAAGAAGG - Intronic
963912995 3:150830898-150830920 AGGAAGGACGGGAGGAAGGAAGG - Intergenic
965125700 3:164626712-164626734 AGATAGGATTGGAGGACAGAAGG - Intergenic
965368182 3:167825110-167825132 AGGAAGGACAGGAGGAAGGAAGG + Intronic
965555978 3:170018843-170018865 ATAAAGGAAGGGAGGAAAGAAGG - Intergenic
966543750 3:181120668-181120690 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
967360511 3:188624905-188624927 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
967461633 3:189754276-189754298 ATGCAAGGATGGAGGAAAGAAGG - Intronic
969715035 4:8864234-8864256 ACGGAGGCCTGGAGGAGAGAAGG + Intronic
969822096 4:9728441-9728463 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
970110813 4:12636027-12636049 AGGGAGGAAGGGAGGAAAGAAGG - Intergenic
970341865 4:15115743-15115765 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971618152 4:28820342-28820364 AGGAAGGAATGGAGGAAAGAAGG + Intergenic
971661694 4:29426096-29426118 AGGAAGGATTGGAGGAAGGATGG - Intergenic
971663970 4:29458238-29458260 AGGAAGGAATGAAGGAAAGATGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
974220460 4:58962688-58962710 AAGGAGGAGGGGAGGAAAGAGGG - Intergenic
974717355 4:65685248-65685270 AAGTAGGAGTGATGGAAAGACGG + Intergenic
974786667 4:66626475-66626497 ATGAAAGACTGGAGAAAACAAGG - Intergenic
975042201 4:69760133-69760155 GAGTAGGACTGGATGAAGGATGG + Intronic
975190324 4:71452854-71452876 ATGTAGTACTGGAAAAAAGGTGG - Intronic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975418366 4:74133140-74133162 ATGTAGGCCAGAAGGAAATAGGG - Intronic
975447532 4:74483476-74483498 ATGTAAGAGTGGGGGAAATAAGG - Intergenic
975642947 4:76518507-76518529 AGGTAGGAAGGAAGGAAAGAAGG - Intronic
975924269 4:79430191-79430213 GTCGAGGGCTGGAGGAAAGATGG - Intergenic
976512537 4:85928319-85928341 AGGAAGGACGGGAGGAAAGGAGG - Intronic
976661219 4:87542856-87542878 AAGAAGGAAGGGAGGAAAGAAGG - Intergenic
976697027 4:87927716-87927738 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
976858910 4:89639519-89639541 AAGAAGGAAAGGAGGAAAGAAGG + Intergenic
977728063 4:100320770-100320792 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
978617359 4:110611074-110611096 ATGAGGGACTGGAGGAAGGGGGG - Intergenic
978790756 4:112661161-112661183 ATGAAGAACTGAAGCAAAGATGG + Intergenic
978797239 4:112720401-112720423 AAGTAAGACTGGAGAAAAGATGG - Intergenic
979411904 4:120389477-120389499 AGGGAGGAATGAAGGAAAGAAGG + Intergenic
979561329 4:122105210-122105232 ATGGAGGACTGCAGGACTGAGGG + Intergenic
979989374 4:127356410-127356432 ATGTAGGATTGCAGGGATGATGG - Intergenic
980828498 4:138101267-138101289 AAGTAGGACTGTAAGAAGGATGG - Intergenic
981064929 4:140473158-140473180 AAATAGGAATGAAGGAAAGAAGG - Intronic
981509813 4:145543657-145543679 ATGTAGAGCTGGAAGAATGATGG - Intronic
981692467 4:147524491-147524513 AGGAAGGACTGAAGGAAGGAGGG + Intronic
983347685 4:166547322-166547344 TAGTAGGACTGGACTAAAGAGGG + Intergenic
983750863 4:171268437-171268459 AGGAAGGACGGGAGGAAGGAAGG - Intergenic
983927498 4:173417610-173417632 ATGAAGGAAGGGAGGAAGGAAGG - Intergenic
984453367 4:179932502-179932524 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
984744312 4:183199158-183199180 AAGCAGGACTTGAGGAAAGCAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985056371 4:186039009-186039031 ATGTACAACTAGAGGAAGGAAGG + Intergenic
985993677 5:3584524-3584546 AGGCAGGACAGGAGGAAGGAAGG + Intergenic
985993779 5:3584932-3584954 AAGAAGGACAGGAGGAAGGAAGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986530131 5:8727095-8727117 AGGTAGGAAGGAAGGAAAGAAGG + Intergenic
986793716 5:11189178-11189200 ATGGAGGAAGGGAGAAAAGAAGG - Intronic
986796518 5:11218010-11218032 AGGGAGGAAGGGAGGAAAGAAGG - Intronic
987276339 5:16366759-16366781 AGGTAGGACTGGGGGAGGGATGG + Intergenic
987722132 5:21650764-21650786 ATGAAGGAGGGAAGGAAAGAAGG - Intergenic
987780494 5:22427742-22427764 AAGCAGGAATGGAGGAGAGAAGG + Intronic
987787866 5:22525507-22525529 AGGAAGGAATGAAGGAAAGAAGG + Intronic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
989183541 5:38601426-38601448 TTGAAGGACTGGAGCAAAGATGG + Intronic
989427394 5:41312610-41312632 AGGAAGGACGGGAGGAAGGAAGG - Exonic
990249872 5:53902849-53902871 ATGGAGAACTAGGGGAAAGAGGG + Intronic
990989957 5:61674954-61674976 CTCCAGGACTGGAGAAAAGAGGG + Intronic
991260970 5:64667657-64667679 ATGAAGGAAGGGAGAAAAGAAGG + Intergenic
992395779 5:76368412-76368434 ATGTAGAGTTGGAGGAGAGAAGG + Intergenic
992720611 5:79557289-79557311 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
993199825 5:84800851-84800873 ATGAAGGATAGAAGGAAAGAAGG + Intergenic
993268006 5:85752397-85752419 ATGTAGGCCTGGAGCAAAAGGGG + Intergenic
993979895 5:94532470-94532492 ATGGAGGAAGGGAGGAAGGAAGG - Intronic
994736077 5:103558168-103558190 TAGTAGAAATGGAGGAAAGAGGG - Intronic
994965758 5:106668910-106668932 AGGTAGGAGGGGAGGAAGGAAGG + Intergenic
995101330 5:108310824-108310846 ATGTAGGACATGTGTAAAGAAGG - Intronic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
996865162 5:128112428-128112450 ATGTAGGACTGGTGGCAACTAGG + Intronic
997007290 5:129833088-129833110 TCGTAGGACTGGAAGAATGAGGG - Intergenic
997332996 5:133080713-133080735 ATGAAGGACTGGACCAAAAATGG - Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
998465611 5:142341504-142341526 GGGTAAGAATGGAGGAAAGAGGG + Intergenic
998589255 5:143460112-143460134 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
999178681 5:149652905-149652927 AAGTAGGTCTTGTGGAAAGAGGG - Intergenic
999693785 5:154170673-154170695 AGGTAGGACTGGAGCAGGGAAGG + Intronic
999967746 5:156827777-156827799 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1000641330 5:163706009-163706031 ATGGAGGACTGGAATAACGAAGG - Intergenic
1000712514 5:164599053-164599075 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1001802846 5:174558757-174558779 ATGAAGGAGGGAAGGAAAGAAGG - Intergenic
1003195008 6:3906603-3906625 AAGTAGGACTGTGGGTAAGAAGG + Intergenic
1003709787 6:8576425-8576447 AGGTAGGGAGGGAGGAAAGAAGG - Intergenic
1004129010 6:12901431-12901453 TTGGAGGAAAGGAGGAAAGAGGG + Intronic
1004169152 6:13282441-13282463 ATGAAGGACTGCAGGAATGAGGG - Intronic
1004761400 6:18670758-18670780 AGGGAGGAAGGGAGGAAAGAAGG - Intergenic
1004771291 6:18785545-18785567 ATGTAGGTATGGGGGATAGATGG - Intergenic
1004842867 6:19606680-19606702 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1005224349 6:23623562-23623584 AGGGAGGAAGGGAGGAAAGAAGG + Intergenic
1005246584 6:23892595-23892617 ATGTGGAATTGGAGGAAAAAAGG - Intergenic
1005274912 6:24206360-24206382 AGGAAGGAATGAAGGAAAGAAGG + Intronic
1005331752 6:24757492-24757514 TTCTAGGACAGGAGCAAAGATGG - Intergenic
1005402640 6:25450727-25450749 AGGGAGGAAAGGAGGAAAGAAGG - Intronic
1005847780 6:29794691-29794713 AGGGAGGAAAGGAGGAAAGAAGG - Intergenic
1006443720 6:34067497-34067519 ATGGAGGAAGGAAGGAAAGAAGG - Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1006891434 6:37432801-37432823 ACGAAGGACGGGAGGACAGAAGG - Intergenic
1007307374 6:40917619-40917641 AGGTAAGAATGGAGCAAAGAGGG + Intergenic
1007375933 6:41456759-41456781 AGGAAGGAGGGGAGGAAAGAAGG - Intergenic
1007441294 6:41863129-41863151 ATCTAGAACTGGAGGAAGGTAGG - Intronic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1008322701 6:50136673-50136695 TTTTAGGACTGGATGATAGAAGG - Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008786027 6:55169275-55169297 ATGCAGGACAGGAGGCAAGATGG + Intronic
1010045012 6:71431735-71431757 ACATAGGAAGGGAGGAAAGAGGG - Intergenic
1010139298 6:72595347-72595369 ATGGATGACTGGAGCAAAGCTGG - Intergenic
1011410672 6:87062886-87062908 AGGAAGGACAGAAGGAAAGAAGG + Intergenic
1011902848 6:92321774-92321796 AAGTATGATTGGAGGACAGAGGG - Intergenic
1012833548 6:104236837-104236859 ATGAATGAATGCAGGAAAGAAGG + Intergenic
1014554879 6:122833655-122833677 ATGGAGGAGGGGAGTAAAGAAGG + Intergenic
1014646723 6:123982952-123982974 AGGAAAGAATGGAGGAAAGAAGG - Intronic
1015085540 6:129286986-129287008 AGGAAGGAAGGGAGGAAAGAGGG + Intronic
1015085562 6:129287057-129287079 AGGAAGGAAGGGAGGAAAGAGGG + Intronic
1015280814 6:131432154-131432176 ATGTAGGACTGAATGCAAGTTGG + Intergenic
1015522755 6:134147795-134147817 TTGGAGGACTGGAGTAAGGAAGG + Intergenic
1016091572 6:139985658-139985680 AGGTAGGAAGGGAGGAAGGAAGG - Intergenic
1016140603 6:140605453-140605475 ATTTTGGAATGGAGCAAAGATGG - Intergenic
1016532575 6:145075051-145075073 AAGAAGGAATGGAGGAAGGAAGG + Intergenic
1016945639 6:149530203-149530225 ATGCAAGACTGGGGGAAAGAGGG + Intronic
1017592851 6:155995527-155995549 ATGTAGGAAAGGAGAAAAAAGGG - Intergenic
1017635205 6:156436527-156436549 ACGTAGGGCTGGAGGAACAAAGG - Intergenic
1017783024 6:157731332-157731354 AGGAAGGACGGGAGGCAAGAAGG + Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020492543 7:8806318-8806340 ATATAGAACTGGAAGAAAAATGG - Intergenic
1020572266 7:9879215-9879237 AGGAAGGAATGGAGGAAGGAAGG + Intergenic
1020666293 7:11047872-11047894 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1020814505 7:12888652-12888674 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1020990088 7:15184824-15184846 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1020990102 7:15184878-15184900 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1021286408 7:18786649-18786671 AGGGAGGAAGGGAGGAAAGAAGG - Intronic
1021656902 7:22881706-22881728 AAGAAAGACTGGAGGGAAGAGGG - Intergenic
1021920340 7:25478731-25478753 ATGTAGGAAGGAAGGAAGGAAGG + Intergenic
1022578291 7:31520861-31520883 ATGTAGGAATGGATTAGAGATGG - Intronic
1023705219 7:42933499-42933521 AGGGAGGAAGGGAGGAAAGAAGG - Intronic
1024298157 7:47862799-47862821 AAGGAGGACAGAAGGAAAGAAGG + Intronic
1024330408 7:48149200-48149222 AGGGAGGACTGAAGGAAGGAAGG - Intergenic
1024360650 7:48463861-48463883 AGGGAGGAATGGAGGAAGGAAGG + Intronic
1024878349 7:54054003-54054025 ATGTGGGACTGTAAGAAAAAGGG + Intergenic
1025022037 7:55487877-55487899 CTGTAGGCCTGGGGGAAGGAAGG - Intronic
1026175979 7:67997586-67997608 AGGAAGGAATGGAGGAAGGAAGG - Intergenic
1026392565 7:69916693-69916715 ATGTAAGAATGGGGGGAAGAGGG - Intronic
1028290229 7:89056531-89056553 ATCTAGGACTGGAGGCAGGAGGG - Intronic
1028921576 7:96315705-96315727 TGCTAGGAATGGAGGAAAGAAGG - Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029084957 7:98004087-98004109 ATGAAGGACAGAAGGAAGGAAGG - Intergenic
1029157394 7:98526878-98526900 ATGAAGGAAGGGAGGAAGGAAGG - Intergenic
1029300793 7:99580903-99580925 AGGGAGGACAGAAGGAAAGAAGG - Intronic
1029600620 7:101561248-101561270 ATGAAGGAAAGGAGGAAGGAAGG - Intergenic
1029862372 7:103586491-103586513 ATGTTGAACTGGAGTAGAGAGGG - Intronic
1031049929 7:116934777-116934799 AGGGAGGACAGGAGGAAGGAAGG - Intergenic
1031323681 7:120365184-120365206 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1031820576 7:126496274-126496296 AGGTAGGAGGGAAGGAAAGAAGG + Intronic
1031820922 7:126500369-126500391 ATGGAAGACAGGAGGAGAGAAGG + Intronic
1031991153 7:128200152-128200174 AAGGAGGAGGGGAGGAAAGACGG - Intergenic
1032284271 7:130528947-130528969 ATGAAGGACAGGAGGGAGGATGG + Intronic
1032484266 7:132271998-132272020 ATGTATGATTGAAGGAAGGAGGG + Intronic
1032799874 7:135309380-135309402 ATGAAGGACTGTAGGAACAATGG - Intergenic
1034752118 7:153578964-153578986 AGATAGGAATGAAGGAAAGAAGG + Intergenic
1035613640 8:986587-986609 AGGAAGGACTGGAGGAGAAAAGG + Intergenic
1035765257 8:2100204-2100226 AGGTAGGAAGGCAGGAAAGAAGG - Intronic
1035902374 8:3471488-3471510 ATGAAGGAAGGAAGGAAAGAAGG - Intronic
1037310067 8:17545718-17545740 AAGCAGGACTGCAGGTAAGAAGG - Intronic
1037406396 8:18547133-18547155 ATGTAAGCCTGGTGGAATGACGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038398485 8:27265036-27265058 AGCTAGGAGTGGTGGAAAGAAGG + Intergenic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1039314562 8:36356832-36356854 ATGAAGGAAGGGAGGAAGGAAGG + Intergenic
1039347188 8:36719126-36719148 AAGTAGGAAGGAAGGAAAGAAGG - Intergenic
1039421165 8:37442392-37442414 ATGGAAGACAGGAGGGAAGAAGG - Intergenic
1039608687 8:38902151-38902173 CTTTAGGACTGGAGGAGAAAAGG - Intronic
1041148125 8:54900964-54900986 AAGTAGGAAGGAAGGAAAGAAGG + Intergenic
1041435483 8:57835724-57835746 AAGTAGTAATGGAGGAAATAGGG - Intergenic
1041809990 8:61897224-61897246 ATGATGGACTGGAGGAATGCAGG - Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042104960 8:65316296-65316318 ATGCAGGCAGGGAGGAAAGAGGG + Intergenic
1042356725 8:67836538-67836560 ATGGAGGTAGGGAGGAAAGAAGG - Intergenic
1042803967 8:72751892-72751914 ATGGAGGCCAGGAGGGAAGAAGG + Intronic
1043007630 8:74839787-74839809 ATGTATCAATGGAAGAAAGAAGG - Intronic
1043613384 8:82093539-82093561 CTTTAGGACAGGAGGATAGATGG - Intergenic
1043826129 8:84930765-84930787 AGGGAGGAAGGGAGGAAAGAGGG + Intergenic
1043863484 8:85349810-85349832 ACCTAGGACTGGAAGAAATAAGG - Intronic
1045253699 8:100502053-100502075 AGGGAGGAAGGGAGGAAAGAAGG + Intergenic
1045755322 8:105534381-105534403 AGGTAGGAAGGGAGGAAGGAAGG - Intronic
1046552582 8:115734992-115735014 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
1046726148 8:117676214-117676236 AGGTAACGCTGGAGGAAAGATGG + Intergenic
1047153958 8:122296272-122296294 AGGGAAGAATGGAGGAAAGAAGG + Intergenic
1047155233 8:122309741-122309763 ATATAGTACAGGGGGAAAGATGG + Intergenic
1047595986 8:126378374-126378396 ATGAAGGAAGGAAGGAAAGAAGG - Intergenic
1048053971 8:130846535-130846557 ATGAAGGAATGAAGGAAGGAAGG - Intronic
1049855947 8:144861983-144862005 TTGTCTGACTGGATGAAAGAGGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1051530811 9:18101123-18101145 ATGTAGGACTTCTAGAAAGATGG - Intergenic
1052093807 9:24361022-24361044 AGGTAAGACTTGAGGATAGAAGG + Intergenic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1052599715 9:30610000-30610022 GTGGAGGACTGGATAAAAGAAGG + Intergenic
1053826839 9:42034271-42034293 ATTCAGGAGTAGAGGAAAGAAGG - Intronic
1054603721 9:67153160-67153182 ATTCAGGAGTAGAGGAAAGAAGG + Intergenic
1054902374 9:70382982-70383004 ATGGAGGAAAGGGGGAAAGAAGG - Intergenic
1054989002 9:71299502-71299524 ATGAAGGAAGGGAGGAAGGAAGG + Intronic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056268407 9:84922826-84922848 ATGAAGGAGTGGGGGAAAGTAGG + Intronic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1056888416 9:90466924-90466946 AACTAGGACAGGAGGAAAGAGGG + Intergenic
1058643327 9:107107906-107107928 AGGGAGGAATGGAGGAAGGAAGG + Intergenic
1058948944 9:109885295-109885317 AGGAAGGAATGGAGGAAGGAAGG + Intronic
1059028972 9:110668659-110668681 GTGTAGGGCTGGAGGAACAAGGG - Intergenic
1059316915 9:113433744-113433766 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1059856500 9:118403939-118403961 ATCTATGAATAGAGGAAAGAGGG - Intergenic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1060710365 9:125857519-125857541 ATGTAGTACTGGGGGTCAGATGG - Intronic
1060977256 9:127771795-127771817 ATGTAGGAGGGGATGACAGAAGG + Intronic
1061026001 9:128050149-128050171 AACTAAGAGTGGAGGAAAGATGG + Intergenic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1062185754 9:135217634-135217656 AAGGAGGAGGGGAGGAAAGAAGG - Intergenic
1203479965 Un_GL000224v1:3470-3492 AGGTAGGACGGAAGGAAGGAAGG + Intergenic
1203416847 Un_KI270330v1:1145-1167 AGGTAGGACGGAAGGAAGGAAGG - Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185680130 X:1881596-1881618 ATGAAGGAATGAAGGAAGGAAGG + Intergenic
1185834082 X:3329024-3329046 ATGAAGGAAGGAAGGAAAGAAGG + Intronic
1185954879 X:4478373-4478395 AGGGAGGAAGGGAGGAAAGAGGG + Intergenic
1186107096 X:6219385-6219407 ATGAAGGAAAGAAGGAAAGAAGG - Intronic
1186269193 X:7866489-7866511 AGGTAGGAAGGGAGGAAAGAAGG - Intergenic
1187500234 X:19833212-19833234 AAGAAGGACTGTGGGAAAGAGGG - Intronic
1188321617 X:28745286-28745308 ATGGAAGACTGAAGGAAACAGGG - Intronic
1189643710 X:43103257-43103279 ATGTTGGACTATAGGAAAAATGG - Intergenic
1190595544 X:52050042-52050064 ATGTAGAAAAGGAGGAAACAAGG + Intergenic
1190613280 X:52204031-52204053 ATGTAGAAAAGGAGGAAACAAGG - Intergenic
1190708679 X:53050045-53050067 AGGAAGGAAAGGAGGAAAGAAGG - Intronic
1191796773 X:65029690-65029712 ATGTGAGACTGGAGGAATAAGGG + Intronic
1192192683 X:69001793-69001815 ATGGAGGACTCCAGGAGAGATGG + Intergenic
1193273600 X:79557796-79557818 ATGAAGGTAGGGAGGAAAGAAGG + Intergenic
1193611125 X:83632308-83632330 AGGTAGGAATGAAGGAAGGAAGG + Intergenic
1193742571 X:85234775-85234797 ATACAGGAAGGGAGGAAAGAAGG + Intergenic
1193948405 X:87766299-87766321 AAGAAGGAAAGGAGGAAAGAAGG - Intergenic
1194140526 X:90203587-90203609 ATGAAGGAAAGAAGGAAAGAAGG - Intergenic
1195375167 X:104219524-104219546 AGGGAGGAAGGGAGGAAAGAAGG + Intergenic
1195870650 X:109481707-109481729 ATGAAGGAAAGAAGGAAAGAAGG - Intronic
1195927402 X:110039509-110039531 AGGTAGGAATGGGGGATAGATGG + Intronic
1196107064 X:111907722-111907744 ATGTAGGATTGGATGAAAGTAGG - Intronic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1197494331 X:127159141-127159163 AGGTTGTACTGTAGGAAAGAAGG - Intergenic
1197573763 X:128182092-128182114 ACCTAGGACTAGAGCAAAGAAGG + Intergenic
1197757492 X:130006003-130006025 ATCTAGGTCTGGAAGAAAGATGG + Intronic
1197856058 X:130915160-130915182 ATTTAGGACTGGAAGAACAATGG + Intergenic
1197956607 X:131956431-131956453 ATGTAGGCCAGAAGGAAATATGG + Intergenic
1198015872 X:132610366-132610388 ATATAGGAATGAAGGGAAGAAGG + Intergenic
1198133984 X:133728373-133728395 AAGAAGGAGTGAAGGAAAGAAGG + Intronic
1198637197 X:138712757-138712779 ATGTAGGAGTCCAGTAAAGACGG - Intronic
1198800548 X:140443887-140443909 TTCTAGGACTGGAGGAAGGAAGG + Intergenic
1199270834 X:145881282-145881304 ATGTAGGGCGTGAGGAAAGCAGG + Intergenic
1199587886 X:149435826-149435848 ATGCAGGACTGCAGCCAAGATGG + Intergenic
1199870383 X:151893172-151893194 AGGGAGAAATGGAGGAAAGAAGG - Intergenic
1199911102 X:152287793-152287815 ATGAAGGAGGAGAGGAAAGAAGG - Intronic
1200096366 X:153665991-153666013 ATGTGGGACTACTGGAAAGATGG - Intergenic
1200486267 Y:3772526-3772548 ATGAAGGAAAGAAGGAAAGAAGG - Intergenic
1201235489 Y:11906555-11906577 ATGAATGAATGGATGAAAGATGG - Intergenic
1201528133 Y:14959473-14959495 AGGAAGGAATGAAGGAAAGAAGG + Intergenic
1201550535 Y:15212560-15212582 AGGAAGGAATGGAGGAAGGAAGG + Intergenic
1201798670 Y:17928742-17928764 AGGAAGGAATGGAGGAAGGAAGG + Intergenic
1201802883 Y:17977215-17977237 AGGAAGGAATGGAGGAAGGAAGG - Intergenic
1202359987 Y:24097389-24097411 AGGAAGGAATGGAGGAAGGAAGG + Intergenic
1202510790 Y:25572725-25572747 AGGAAGGAATGGAGGAAGGAAGG - Intergenic