ID: 1042046490

View in Genome Browser
Species Human (GRCh38)
Location 8:64658141-64658163
Sequence ATCTATAAGGTAATGATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042046490_1042046495 5 Left 1042046490 8:64658141-64658163 CCTAACATCATTACCTTATAGAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1042046495 8:64658169-64658191 TTTCAAGATACGAATTTAGGGGG No data
1042046490_1042046496 20 Left 1042046490 8:64658141-64658163 CCTAACATCATTACCTTATAGAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1042046496 8:64658184-64658206 TTAGGGGGAACACAAACATTTGG No data
1042046490_1042046492 2 Left 1042046490 8:64658141-64658163 CCTAACATCATTACCTTATAGAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1042046492 8:64658166-64658188 GAATTTCAAGATACGAATTTAGG No data
1042046490_1042046493 3 Left 1042046490 8:64658141-64658163 CCTAACATCATTACCTTATAGAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1042046493 8:64658167-64658189 AATTTCAAGATACGAATTTAGGG No data
1042046490_1042046494 4 Left 1042046490 8:64658141-64658163 CCTAACATCATTACCTTATAGAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1042046494 8:64658168-64658190 ATTTCAAGATACGAATTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042046490 Original CRISPR ATCTATAAGGTAATGATGTT AGG (reversed) Intronic
903444340 1:23411667-23411689 AGTTATAAGATAATGCTGTTTGG + Intronic
904213894 1:28904494-28904516 ACCTCTAAGGTAATGGTATTTGG + Intronic
904788533 1:33000266-33000288 ATGTATAAGGTAATGAGAATGGG + Intergenic
905767167 1:40610671-40610693 ATTTATAAGGTAATGGGGTTTGG + Intergenic
907612393 1:55885582-55885604 ATCTATAACATGAAGATGTTGGG + Intergenic
908394228 1:63710831-63710853 ATCTAGAAGTAAATGATGCTGGG - Intergenic
909231560 1:73097894-73097916 AACAATAACATAATGATGTTTGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909991957 1:82234544-82234566 ATCAGTGATGTAATGATGTTGGG + Intergenic
911833962 1:102592375-102592397 ATCTATTAGGCATGGATGTTAGG - Intergenic
912045656 1:105452302-105452324 ATATATGAGGACATGATGTTTGG + Intergenic
912594470 1:110860164-110860186 ATCTATAAGTTACTGATTATTGG + Intergenic
917400022 1:174637424-174637446 ATCTTTAAAGTAATCATGTGCGG - Exonic
918889421 1:190246245-190246267 GTCAAGAAGGTAATGATGTAAGG - Intronic
919117849 1:193303477-193303499 ATCTCTAATGTGATGATATTTGG - Intergenic
921721290 1:218474635-218474657 ATCTTTACACTAATGATGTTGGG - Intergenic
921780097 1:219152732-219152754 ATTTATTAGGTAATGTTATTAGG + Intergenic
922524713 1:226291711-226291733 TACTATAAGATATTGATGTTAGG - Intronic
924275882 1:242386282-242386304 ACCTCTAAGGTAATTATTTTGGG - Intronic
1063776063 10:9266139-9266161 ATATTTAAAGTAATGAAGTTTGG + Intergenic
1064423092 10:15206963-15206985 GTCTACAAGGCAATAATGTTAGG - Intergenic
1067356411 10:45532433-45532455 ATCCATAATGTAATGGTATTTGG + Intronic
1067396210 10:45921583-45921605 ATTTATAACGTTTTGATGTTTGG - Intergenic
1067681312 10:48443092-48443114 CTATGTAAGGTAATCATGTTTGG + Intergenic
1067718748 10:48710369-48710391 ATCTCTAAGGTAATGGTGTCAGG - Intronic
1067864526 10:49890705-49890727 ATTTATAATGTTTTGATGTTTGG - Intronic
1067959549 10:50832997-50833019 ATCTATCAGCTAATGATACTGGG - Intronic
1068446032 10:57125086-57125108 ATTTTCAATGTAATGATGTTGGG + Intergenic
1068766634 10:60771723-60771745 ATCCTCAAGGTAATGATATTGGG + Intergenic
1071770587 10:88725397-88725419 ATCTATAAAGCATTTATGTTAGG + Intronic
1075191787 10:120316021-120316043 ATCCATAAGGTGATGATATTTGG + Intergenic
1078071012 11:8110424-8110446 ATCCATTAAGTAATTATGTTTGG - Exonic
1078307289 11:10202803-10202825 GTCCCTAAGGTAATGATTTTTGG - Intronic
1079369333 11:19837004-19837026 ATCCCTAATGTAATGGTGTTTGG - Intronic
1079590534 11:22177700-22177722 ATATATAAGTTAAGGATCTTGGG - Intergenic
1082097689 11:48144587-48144609 ATCTACATGGTGGTGATGTTGGG - Intronic
1082721671 11:56685079-56685101 ATCTGTAAGTAGATGATGTTTGG + Intergenic
1082830772 11:57615383-57615405 ATCTGTAAGGTATAGTTGTTGGG + Intergenic
1083064106 11:59905607-59905629 AGCAAGAACGTAATGATGTTTGG + Intergenic
1086054633 11:82632008-82632030 ATTTTTAAGTTACTGATGTTGGG + Intergenic
1086206300 11:84262105-84262127 ATCTATAAGATAATCATAATTGG - Intronic
1087304328 11:96471291-96471313 ACCTATAAAGTAAGGATCTTGGG - Intronic
1087404633 11:97715490-97715512 ACCGATAATGAAATGATGTTAGG - Intergenic
1088314786 11:108497250-108497272 ATCTAAAAGTGAATTATGTTTGG + Intronic
1088427763 11:109723561-109723583 ATCCACAAGGTGATGGTGTTAGG - Intergenic
1092437363 12:8460781-8460803 ATATATAAGGTAACCTTGTTTGG - Intronic
1092688684 12:11081846-11081868 ATTTATAAAGTAAGGATGTTAGG - Intronic
1093116660 12:15220638-15220660 CTTTATAAGGTAATCATGCTTGG + Intronic
1093554236 12:20451600-20451622 AACTATAAGGTAATGAGGCTGGG - Intronic
1093870050 12:24280062-24280084 ATTTGTAAGGTATTGATTTTAGG - Intergenic
1095301206 12:40586003-40586025 ACCTCTACAGTAATGATGTTAGG - Intergenic
1097622823 12:61962317-61962339 ATCTGTAAGGAAAAGATGATGGG - Intronic
1097971724 12:65640077-65640099 ATCTTTAAAGTCATGCTGTTGGG - Intergenic
1098051074 12:66453808-66453830 AGCTAGAAGGTAATGATGCTGGG + Intronic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1098600528 12:72326270-72326292 ATCTATAAAATAATAGTGTTTGG + Intronic
1098807564 12:75038718-75038740 ATCTATAGTTTAATAATGTTTGG + Intergenic
1099745457 12:86697155-86697177 ATACATAAGGTCATGATCTTTGG - Intronic
1100535946 12:95509307-95509329 CTCTAAAAGAAAATGATGTTTGG + Intronic
1101209640 12:102523179-102523201 ATCTATCAGGACACGATGTTAGG - Intergenic
1104756200 12:131270824-131270846 CTCTCTGAGGTAATCATGTTTGG - Intergenic
1104777578 12:131400201-131400223 CTCTCTGAGGTAATCATGTTTGG + Intergenic
1106097835 13:26664325-26664347 ATGGATAAAGTAATGGTGTTAGG + Intronic
1106590017 13:31090868-31090890 ATCTATATGGTAATGATGACTGG + Intergenic
1106692240 13:32130769-32130791 ATCTAAAAGGTAAAGATGAATGG - Intronic
1106930680 13:34660796-34660818 ATCTTTAACGTGATGGTGTTAGG - Intergenic
1107331942 13:39310822-39310844 ATCTGTAATGTAATGGTATTTGG - Intergenic
1107566117 13:41606459-41606481 ATATAAAAGGTACTGATATTAGG + Intronic
1107566241 13:41607870-41607892 ATATAAAAGGTACTGATATTAGG + Intronic
1110109132 13:71721124-71721146 ATGTATAGGGAAATCATGTTTGG - Intronic
1110470847 13:75858128-75858150 ATTTATAAGGTAATTGTGTGTGG + Exonic
1110603325 13:77401692-77401714 ACCTCCAAGGTAATGATATTAGG - Intergenic
1111083927 13:83348864-83348886 ATCTATCTGCTAATGATTTTAGG - Intergenic
1111186628 13:84745467-84745489 ATCTATAAGATAATTACTTTTGG + Intergenic
1113345087 13:109469458-109469480 ATCCATAGGGTGATGGTGTTAGG + Intergenic
1114738094 14:25063663-25063685 ACCTCTAAGGTAATGATATTAGG + Intergenic
1114883783 14:26821990-26822012 ATCTAAAAGGTAAGAATTTTAGG - Intergenic
1117232816 14:53738942-53738964 GTCTATTAGCTAATAATGTTTGG + Intergenic
1117885103 14:60352833-60352855 ATTTTTAAGGTAATGCTGTATGG - Intergenic
1118290155 14:64512906-64512928 ATCTTTAAGGTCATGATCTTGGG + Intronic
1118552015 14:66962975-66962997 ATCTCTAAGATAAGGATGTATGG - Intronic
1120720299 14:87883009-87883031 TTCTATGAGGTCATGATGGTGGG + Intronic
1123775205 15:23572912-23572934 ATCTCTAAGGTAATGGTATTAGG - Intronic
1127539871 15:59926716-59926738 ATCAATAAGGTCATCATTTTAGG + Intergenic
1127620146 15:60726120-60726142 AGCTATTAGGTGATGAGGTTGGG + Intronic
1129261618 15:74371655-74371677 ATGTTTAAGGCAATGATATTAGG - Intergenic
1129497492 15:75999261-75999283 ATCTATAAACTGATAATGTTGGG + Intronic
1132068764 15:98756145-98756167 TTCTATCAGGTATTGATATTAGG + Intronic
1133004693 16:2872781-2872803 ATCTTTGAGGTTATGATGTTAGG + Intergenic
1135619179 16:23939348-23939370 ATCTACAAAGTAATTTTGTTGGG - Intronic
1146283727 17:31560532-31560554 ATCTTTAATGAAATGGTGTTTGG - Intergenic
1149699057 17:58639938-58639960 ATTTTTAAGATAAAGATGTTTGG + Intronic
1157017323 18:43732197-43732219 TCATATAAGGTAATTATGTTTGG + Intergenic
1158441792 18:57481476-57481498 ATCTAAAAGGTATTTATTTTTGG - Exonic
1158837035 18:61341616-61341638 TTCAATGAGGTAATGATGGTTGG - Intronic
1159414968 18:68134555-68134577 ATTTATAAAGTAATTATTTTTGG - Intergenic
925432688 2:3809329-3809351 ATCTACATGCTAATGATATTGGG + Intronic
926377472 2:12248077-12248099 ATCTGTAAGTTAAAGATGGTTGG - Intergenic
926538797 2:14148827-14148849 ATCAATATGTTAATGATATTAGG - Intergenic
928006469 2:27566590-27566612 TTCTATAAGTAATTGATGTTGGG + Intronic
929327322 2:40632182-40632204 ATCTAATAGAAAATGATGTTTGG - Intergenic
931257793 2:60588895-60588917 AGCTATAAGCTAATGAAGGTTGG - Intergenic
933561115 2:83887335-83887357 ACCTCTAATGTAATGGTGTTTGG - Intergenic
933876808 2:86628060-86628082 ATATATAATATAATCATGTTGGG - Intronic
935689852 2:105721153-105721175 ATCTCTAAAGTGATGGTGTTAGG - Intergenic
942006920 2:171711910-171711932 ATATATAAGATAATTATGTATGG - Intronic
943542655 2:189236982-189237004 ATGTAAAAGGTAATGAAGTATGG - Intergenic
945888107 2:215398723-215398745 TTCTTTAAAGTAATGATATTAGG - Intronic
946787813 2:223266269-223266291 AACTATAAGATAATAATTTTGGG + Intergenic
1170499146 20:16956974-16956996 ATCACCAATGTAATGATGTTAGG + Intergenic
1173055523 20:39608568-39608590 ATCTCTAAGGTATATATGTTAGG + Intergenic
1175630955 20:60536030-60536052 ATCTCTAAGGTAATGGTATTGGG + Intergenic
1177111242 21:17032134-17032156 ACCTATAAGGTAATAATGTCTGG - Intergenic
1177211341 21:18075795-18075817 ACCTATAAGATAATGGCGTTAGG + Intronic
1179425368 21:41273957-41273979 ATCTCCAAGGTGATGATATTTGG + Intronic
1182170256 22:28221444-28221466 AACTTTAAGGTATTGGTGTTGGG + Intronic
949117402 3:343781-343803 ATCTCAAAGGAAATGATGTTGGG - Intronic
949204866 3:1425918-1425940 ATATAGAAGGAAATAATGTTTGG + Intergenic
949363431 3:3255616-3255638 AGCTATAAGGTAATAAATTTAGG - Intergenic
949424698 3:3904501-3904523 ATCTATAAAGTGAGGATGCTAGG - Intronic
950703105 3:14763497-14763519 ATCCCTAAGGTGATGGTGTTGGG - Intronic
951223919 3:20098548-20098570 ATCTATAAGATGATGAAGCTGGG - Intronic
951366483 3:21789200-21789222 ATCTATAATATAATTATCTTTGG + Intronic
952181989 3:30926609-30926631 ATCTCTTAGCTAATGGTGTTTGG + Intergenic
953058949 3:39410991-39411013 AACAACAAGGTAATGATTTTAGG + Exonic
953663217 3:44906027-44906049 ATCTATAAGGTGAGCAGGTTAGG - Intronic
953814640 3:46144479-46144501 ATCTCTATGGTATTGATCTTTGG + Intergenic
957231151 3:77517226-77517248 ATGTATAAGGGAATGATATTTGG + Intronic
957543181 3:81602644-81602666 ATCTCTAAGGTGATCATATTAGG - Intronic
959014759 3:101121257-101121279 ACCTACAAGGTAATGGTATTAGG - Intergenic
962782963 3:138739057-138739079 ATCTCTAATGTGATGATATTTGG + Intronic
963512084 3:146258915-146258937 GACTCTAAGGTAATAATGTTAGG - Intergenic
965083582 3:164066025-164066047 ATCTCTAAGGTTATAATATTTGG - Intergenic
965883655 3:173417664-173417686 ATTTCAAAGATAATGATGTTTGG + Intronic
966011341 3:175081894-175081916 ATCTTAAAGGCAATGATGATTGG + Intronic
970715996 4:18923699-18923721 ATCTATAAGGAAATGAATTTTGG - Intergenic
972038129 4:34553191-34553213 ATCTCCAACATAATGATGTTTGG - Intergenic
972926502 4:44015371-44015393 ATCTATATTTTATTGATGTTAGG + Intergenic
973174480 4:47187754-47187776 AGCTATAAGGAAATGAGGTTTGG - Intronic
973711359 4:53633068-53633090 AGCTAAAAAGTGATGATGTTGGG - Intronic
976403786 4:84638184-84638206 ATCTAGAAGTTAGTGGTGTTGGG - Intronic
976625067 4:87171592-87171614 CTCTAGAATGTAACGATGTTAGG + Intronic
976683712 4:87786928-87786950 ATCTTTAATGTAATGGTATTTGG + Intergenic
981585463 4:146296947-146296969 TTCTATAAGGCAAAGAAGTTTGG - Intronic
983300622 4:165920739-165920761 AGTTATATGGTAATGGTGTTTGG + Intronic
985230199 4:187807701-187807723 ATCTATAAGTAAAAGATGTTTGG + Intergenic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
986797762 5:11228798-11228820 ATCTATATGCTATTGATATTTGG + Intronic
987436105 5:17895786-17895808 ATAAATGAGTTAATGATGTTGGG - Intergenic
988589211 5:32534447-32534469 ATCTATAAGGTAAAATTGATGGG + Intronic
989221024 5:38964224-38964246 ATATAAAAGGTAATGATGGAAGG - Intronic
990245935 5:53863517-53863539 ATTTATAAAGTGAGGATGTTGGG + Intergenic
990654369 5:57938498-57938520 ATGAATAAGGCAATAATGTTTGG - Intergenic
992712787 5:79477093-79477115 CTCTATAATGTTATAATGTTGGG - Intronic
993158098 5:84253110-84253132 ATGCATAAGGTAATTAAGTTAGG + Intronic
993839026 5:92853064-92853086 ATGTATAAGGGAATGATGGTGGG + Intergenic
995123103 5:108556067-108556089 ATTTAGAAGGTAATATTGTTAGG + Intergenic
995284383 5:110369893-110369915 ATCAATTAAGTAATGAAGTTTGG - Intronic
995859213 5:116624100-116624122 ATCTATAAAATAAGGAGGTTGGG - Intergenic
996402820 5:123081977-123081999 ATCTGTAAGGAAAGGATCTTTGG - Intergenic
997043760 5:130289099-130289121 ATATGTAAGGTAATGGAGTTGGG - Intergenic
997154332 5:131537037-131537059 AACTAAAAGGTAATAACGTTAGG + Intronic
1000447165 5:161336312-161336334 ATGTATAATGTTATAATGTTGGG + Intronic
1000694167 5:164359289-164359311 ATGTATATGTTGATGATGTTTGG + Intergenic
1001183608 5:169545255-169545277 GTCTATAACGTAATGTTGTAAGG + Intergenic
1001459683 5:171900151-171900173 ATCTTTAAGGAAATGATGGCTGG - Intronic
1002345215 5:178544044-178544066 ATCTCCAAGGTAATGGTGTTAGG - Intronic
1003456114 6:6284095-6284117 ATGCATAAGGTAATCATATTTGG - Intronic
1003648405 6:7935435-7935457 GTCTCTCAGGTAAAGATGTTTGG - Intronic
1005904867 6:30253478-30253500 ATCTCTAATGTGATGGTGTTTGG + Intergenic
1005922020 6:30410251-30410273 ATCTCTAATGTGATGGTGTTTGG - Intergenic
1009956287 6:70458517-70458539 ACATACAAGGTAATCATGTTGGG - Intronic
1010145669 6:72666372-72666394 ATCGATAATGTCATGATTTTGGG - Intronic
1010312499 6:74403901-74403923 ATCTATTATTTAATAATGTTAGG + Intergenic
1010533972 6:77002753-77002775 ATCCCCAAGGTAATGATATTAGG - Intergenic
1010634922 6:78246949-78246971 ATGTAAAAAGTAATGATGATAGG + Intergenic
1010951975 6:82048013-82048035 AGCTATTAGGGAATGATATTTGG - Intergenic
1012160042 6:95873293-95873315 ATCCTTAAGGTGATGATATTTGG + Intergenic
1013098934 6:106971955-106971977 ATTCAGAAGTTAATGATGTTGGG - Intronic
1014642173 6:123926129-123926151 ATCAACAATGTAATGATATTAGG - Intronic
1015321937 6:131886023-131886045 GACTATGAGGTAAAGATGTTTGG + Intronic
1015887884 6:137939066-137939088 TTTTATAATGTAATGATTTTTGG + Intergenic
1016400644 6:143676665-143676687 ATTTATAAGGAAATGTAGTTAGG + Intronic
1016678646 6:146802391-146802413 ATCTTAAAGTTAATGATGATTGG + Intronic
1017538414 6:155373365-155373387 ATCTCTAAGCTTCTGATGTTGGG - Intergenic
1020498687 7:8889488-8889510 ATCCCTAAGGTGATGGTGTTTGG - Intergenic
1021921194 7:25486682-25486704 ATGTACAAGGTATCGATGTTTGG - Intergenic
1024916573 7:54506950-54506972 ATCTTTGATGTATTGATGTTGGG - Intergenic
1026449131 7:70511969-70511991 ATTTATAAGCTCATGAAGTTGGG - Intronic
1027754587 7:82196223-82196245 CTCTTTAAAGTAAGGATGTTTGG + Intronic
1030710592 7:112744234-112744256 ATATATAGGGTAATGATACTTGG - Intergenic
1030854587 7:114538631-114538653 ATCTTTAAAATAAAGATGTTGGG + Intronic
1033030389 7:137820619-137820641 TTCTAGAAGGTTATGAGGTTGGG - Intronic
1033061940 7:138118118-138118140 ATCTATAAGCAACTGATCTTGGG - Intergenic
1033407653 7:141085960-141085982 ATTAATAAGATAATGATGTATGG + Intronic
1042046490 8:64658141-64658163 ATCTATAAGGTAATGATGTTAGG - Intronic
1043326903 8:79063295-79063317 ATGTATTAGGTAAAGATTTTTGG - Intergenic
1044021217 8:87108297-87108319 ATTTATAATGTTATAATGTTTGG + Intronic
1045306247 8:100958900-100958922 AACTATATGGTAAGGATGTAAGG - Intergenic
1046092193 8:109516510-109516532 ATCTTCAAGGTGATGATATTTGG - Intronic
1046208508 8:111037051-111037073 ATCTATAATATAATTAAGTTAGG - Intergenic
1046893404 8:119447721-119447743 ATCTAGAGAATAATGATGTTGGG + Intergenic
1047068976 8:121321113-121321135 ATCTATAAAGTAATTATATTAGG - Intergenic
1047940217 8:129822156-129822178 CTTTATAAGGTAAAGAAGTTCGG - Intergenic
1048154774 8:131936210-131936232 ATCTATATGAGAATGATGTTAGG + Intronic
1051433928 9:17010569-17010591 ATCTAAACGGAAATGAAGTTTGG + Intergenic
1051662660 9:19440379-19440401 ATTAATAAGGTGATGATATTAGG + Intronic
1052143142 9:25013322-25013344 ATTTTTAAGGTGATGTTGTTAGG - Intergenic
1052544562 9:29858462-29858484 ATCTATAATGTAATGTTTCTTGG + Intergenic
1054383516 9:64520611-64520633 ATATATCCAGTAATGATGTTGGG - Intergenic
1056249079 9:84729888-84729910 TTCTATATGGTACTGATATTTGG + Intronic
1056877222 9:90345470-90345492 GTCTCTAAGGTAATCATGTGTGG + Intergenic
1057057715 9:91976738-91976760 ATCTATAATAGAATGAAGTTGGG + Intergenic
1059897148 9:118879029-118879051 ATTTATAAAGAAATGATATTTGG + Intergenic
1185842574 X:3406411-3406433 ATCTCCAAGGTGATGGTGTTGGG + Intergenic
1185876358 X:3705361-3705383 ATCCCCAAGGTAATGGTGTTAGG - Intronic
1185993456 X:4916937-4916959 ATGTAGAAGGTAGTCATGTTAGG - Intergenic
1189681045 X:43516774-43516796 ATCTTTTAGCTAATGATGTATGG + Intergenic
1190224544 X:48534965-48534987 GTCTATAAGGTAATGATAGACGG - Intergenic
1193511931 X:82412856-82412878 ATCCACAAGGTGATGATATTAGG - Intergenic
1193522234 X:82545069-82545091 ATCTACAAGGAAATTATGCTGGG - Intergenic
1193743047 X:85242016-85242038 CTGAACAAGGTAATGATGTTAGG + Intergenic
1194550674 X:95294813-95294835 ATCTATAAAGAAAAGAGGTTTGG - Intergenic
1196136583 X:112216448-112216470 ATCTTTAAAGAAAGGATGTTTGG + Intergenic
1196194597 X:112826497-112826519 ATCTGCAAGGTAATTATTTTAGG + Intronic
1196609070 X:117690337-117690359 ATCTTTAATGTGATGATATTTGG - Intergenic
1196688252 X:118531158-118531180 ATGTATAAGGAAGTGAGGTTGGG + Intronic
1198487877 X:137106539-137106561 ATTTATAAGGGAATGCTGTCAGG - Intergenic
1199405716 X:147456891-147456913 ATCAATAATGTAAAGATTTTTGG + Intergenic