ID: 1042046635

View in Genome Browser
Species Human (GRCh38)
Location 8:64660366-64660388
Sequence GAATCACTCTAAGCCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042046635 Original CRISPR GAATCACTCTAAGCCATGCC TGG (reversed) Intronic
900974443 1:6008328-6008350 GAATCACTCAGAGCCAGGCACGG + Intronic
902801547 1:18833074-18833096 GAATCACTGTGAGCCAAGCAAGG - Intergenic
902945401 1:19833303-19833325 AAATCACTCTCAGCCAGGCATGG + Intergenic
903390614 1:22961170-22961192 AAATCACTTTATGCCATGCCTGG - Intronic
911189338 1:94932393-94932415 CAATCATTCTAAACCAGGCCTGG - Intergenic
917263066 1:173190477-173190499 GAGTCATTCTGAGCCCTGCCAGG + Intronic
918579703 1:186111357-186111379 GAATCACTCTGAGCCAGGTGTGG + Intronic
920525777 1:206664821-206664843 GCATCACTGTCACCCATGCCTGG + Intronic
921745333 1:218733826-218733848 GGATCTAGCTAAGCCATGCCTGG + Intergenic
923908076 1:238408316-238408338 AAATAACTCTAAGCCAGGCACGG + Intergenic
1063540818 10:6932061-6932083 AAAACACTCAAAACCATGCCTGG + Intergenic
1063971587 10:11384925-11384947 GCATCCCTCCCAGCCATGCCAGG + Intergenic
1064939313 10:20714863-20714885 GAAGCCAGCTAAGCCATGCCTGG - Intergenic
1071497448 10:86178840-86178862 GAAACACTCTAAGGCTTCCCTGG - Intronic
1073791080 10:106941139-106941161 AAAGCACTTGAAGCCATGCCTGG + Intronic
1075878253 10:125825558-125825580 GAATTGCTCTAAGCAATTCCAGG + Intronic
1081431895 11:42985553-42985575 GCATCACTCTAAGCCAGGAACGG - Intergenic
1085942667 11:81223494-81223516 TAATCACTCTTAACAATGCCAGG + Intergenic
1096373998 12:51092535-51092557 GGATCACTTTAAGCCAGGTCAGG - Intergenic
1103287081 12:119811517-119811539 CAATCAATCTAAACAATGCCAGG + Intronic
1103706136 12:122873923-122873945 GATTCACTCAAAGCCAAGCCTGG + Intronic
1104864129 12:131942756-131942778 GAATCTCCCTGAGCCCTGCCTGG - Intronic
1108106940 13:47020790-47020812 GGATCCCGTTAAGCCATGCCTGG + Intergenic
1109281472 13:60361403-60361425 GGACCCGTCTAAGCCATGCCTGG + Intergenic
1111590252 13:90337118-90337140 CAATCACACAAAGCCAAGCCAGG - Intergenic
1113648942 13:112020213-112020235 GAATCAGGCTCACCCATGCCTGG + Intergenic
1115951049 14:38721923-38721945 GACACACTCTCAGCCATGGCTGG + Intergenic
1117812393 14:59561996-59562018 GAGGCACTCTCAGCCACGCCAGG + Intronic
1121255255 14:92525968-92525990 GAGCCACACAAAGCCATGCCTGG + Intronic
1129742673 15:77997387-77997409 GAATCTCACAGAGCCATGCCTGG + Exonic
1130976083 15:88776349-88776371 GAATCACTTGAAGCCAGGCATGG + Intergenic
1131424739 15:92336389-92336411 CAACCACTCTAATCCAGGCCAGG - Intergenic
1131651002 15:94399713-94399735 GACTCAATCTGACCCATGCCAGG + Intronic
1133855320 16:9544191-9544213 TGGTCACTCCAAGCCATGCCAGG - Intergenic
1135708434 16:24694943-24694965 GAATCACTGTGAGCCATCTCTGG + Intergenic
1138671485 16:58618895-58618917 GAATTAATCTAATCCACGCCAGG + Intronic
1145017130 17:19406509-19406531 GAGCCACACTAAGCCAGGCCTGG - Intergenic
1148017354 17:44531441-44531463 GAACCCAGCTAAGCCATGCCTGG + Intergenic
1151658510 17:75506855-75506877 GCATCAGTCCAACCCATGCCTGG - Exonic
1154205651 18:12334577-12334599 GAATGACTCCAAGGCATCCCTGG - Intronic
1155652354 18:28157179-28157201 GAATCAATCTGAGCCATGATTGG - Intronic
1156092335 18:33486922-33486944 GAACCTGTCTAAGGCATGCCTGG + Intergenic
1156613119 18:38750985-38751007 GATTCACTCTATGACATGCCTGG - Intergenic
1165889402 19:39101413-39101435 CAGTCACTCGAGGCCATGCCTGG - Intronic
1167178470 19:47882979-47883001 GAAGCAGTCTGAGCCATGCAAGG + Intronic
925639541 2:5974370-5974392 TAAGCACTGTAATCCATGCCTGG + Intergenic
925793103 2:7512916-7512938 GAATCCAGCCAAGCCATGCCTGG + Intergenic
927279234 2:21289060-21289082 GTAACACTCCAAGCCATCCCAGG - Intergenic
929035133 2:37683472-37683494 TAATCACCCTAGGCCATGACAGG + Intronic
933536139 2:83577401-83577423 ATATGACTCTAAGCCAAGCCTGG - Intergenic
937473267 2:122191575-122191597 GACTCTCTGTGAGCCATGCCAGG + Intergenic
942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG + Intergenic
945385387 2:209193068-209193090 GAATCACTCTAATACATGTGTGG - Intergenic
945826831 2:214731222-214731244 GAATGACTCTAAACAGTGCCAGG - Intronic
1168769165 20:403452-403474 AAAGCACTCAAAGCCATGTCTGG - Intergenic
1177238590 21:18426980-18427002 TAATCACTCTAAACCAGGCATGG - Intronic
1178258912 21:31080671-31080693 GGATCCAGCTAAGCCATGCCTGG + Intergenic
1181734911 22:24874066-24874088 TAATCACCCAAAGCCCTGCCAGG - Intronic
949368590 3:3309989-3310011 AAATGACTCTAAGCCCTGTCAGG + Intergenic
949843389 3:8345080-8345102 TAATCACTCAAAGCCAACCCAGG + Intergenic
950538083 3:13593268-13593290 GATTAACTTTAACCCATGCCCGG - Intronic
950888630 3:16383122-16383144 GAACTACCCAAAGCCATGCCTGG + Intronic
953683249 3:45056085-45056107 GACTCATTCTAAGCAATTCCTGG - Intergenic
954674274 3:52307107-52307129 GGAGCACTTTAAGCCATGACGGG - Intergenic
954835609 3:53464670-53464692 GACTCACTCTATTCCATACCTGG + Intergenic
955918948 3:63934395-63934417 GAACCACTCTGAGCCATGGGTGG + Intronic
961588803 3:127959334-127959356 GAGTTACTCTAAGTCATGTCAGG + Intronic
964405544 3:156344651-156344673 GAATCACTCAAAACCATCCCAGG - Intronic
967938179 3:194746076-194746098 GGCACACTCTGAGCCATGCCAGG + Intergenic
970602615 4:17652510-17652532 GACTCACAGTAAGCCATCCCAGG + Intronic
970744445 4:19278648-19278670 AAATCCAGCTAAGCCATGCCTGG - Intergenic
975127320 4:70797552-70797574 GAACCACTCTAGGCCAGGCACGG + Intronic
976110867 4:81672434-81672456 GAATTACTCAATCCCATGCCAGG + Intronic
983113258 4:163780314-163780336 GAATCACTCTTTGCCAGGACAGG + Intronic
983246085 4:165289050-165289072 AAGTCACTCTAAGGCATGCATGG - Intronic
988735424 5:34015735-34015757 GAATCTGCCTGAGCCATGCCTGG + Intronic
991142984 5:63268326-63268348 GAATCCCTCTAAGTTATCCCTGG + Intergenic
992180229 5:74189058-74189080 GAATCCAGCTAAACCATGCCTGG - Intergenic
994198139 5:96942361-96942383 GAATCACTCTAGGCCCAGCGCGG + Intronic
996499180 5:124197906-124197928 GAATCACTTTAAAGCATTCCTGG - Intergenic
996792279 5:127305743-127305765 GAGGCACTCTAAACCATCCCCGG - Intronic
997234798 5:132266567-132266589 GGCTCACTCTGAGCCAGGCCAGG - Intronic
1003408191 6:5840295-5840317 GAATCCCTCTAAGCCCTGGATGG - Intergenic
1003480705 6:6529959-6529981 GCATCTAGCTAAGCCATGCCTGG - Intergenic
1004218963 6:13729091-13729113 GGATTCCACTAAGCCATGCCAGG - Intergenic
1004578343 6:16922275-16922297 AAATGACTCTAGGCCATCCCTGG + Intergenic
1005650107 6:27878397-27878419 GCATCAATTCAAGCCATGCCAGG - Intergenic
1006000648 6:30962576-30962598 CAATCACTGTATCCCATGCCTGG + Intergenic
1008077778 6:47163670-47163692 CAATGACTCTAAGGCATGCATGG - Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1015635893 6:135273668-135273690 AAATCACTCTTAGCCAAGCGTGG - Intergenic
1017423076 6:154293249-154293271 GTATCACTCTAAACCTTGTCTGG - Intronic
1024594778 7:50922807-50922829 GAATGGCTCTATGCCATGCTGGG - Intergenic
1030239501 7:107305564-107305586 GGACCAAACTAAGCCATGCCAGG - Intronic
1030900811 7:115120950-115120972 CAATCACTCTGAGCCTTGTCAGG - Intergenic
1031180547 7:118409219-118409241 GAAGCAATCAAAGCCTTGCCTGG - Intergenic
1031434404 7:121714553-121714575 GAATCACTTTGAACCATTCCTGG - Intergenic
1031993751 7:128214890-128214912 GAAGCACTCAAAGCAATGCTAGG - Intergenic
1032554403 7:132816697-132816719 TGATCACTCCAAGCCATTCCAGG + Intronic
1034384652 7:150730119-150730141 GGATCCATCTAAGCCATGTCTGG - Intronic
1042046635 8:64660366-64660388 GAATCACTCTAAGCCATGCCTGG - Intronic
1044323423 8:90832001-90832023 GACTCACTCTAAACCATTACTGG + Intronic
1046542422 8:115603775-115603797 GAATCACTCTCAACAATTCCCGG + Intronic
1057177749 9:93011866-93011888 GAATCACTCTAGGCCAGGCGCGG + Intronic
1060598797 9:124864170-124864192 AAAAAAGTCTAAGCCATGCCGGG - Intronic
1186836670 X:13445210-13445232 GGATCCAGCTAAGCCATGCCTGG - Intergenic
1187202196 X:17145812-17145834 GAAACACTCAATGCCAGGCCGGG + Intronic
1190211444 X:48451776-48451798 GAATAACTCCAACACATGCCTGG + Intergenic
1194647466 X:96474932-96474954 GAATGACTCAAAGCCATTCTGGG - Intergenic
1195498482 X:105566012-105566034 GAATCACTATAAGCCAAGTTAGG - Intronic
1198053588 X:132972581-132972603 GAATCACTTGAAGCCAACCCAGG - Intergenic
1199880204 X:151968293-151968315 GAACCCAGCTAAGCCATGCCTGG + Intronic
1200687615 Y:6270802-6270824 AAAAAACTCAAAGCCATGCCAGG - Intergenic
1201047656 Y:9903907-9903929 AAAAAACTCAAAGCCATGCCAGG + Intergenic