ID: 1042052585

View in Genome Browser
Species Human (GRCh38)
Location 8:64727168-64727190
Sequence CCCTGGGAGTTCTACTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042052569_1042052585 29 Left 1042052569 8:64727116-64727138 CCTCCACTTTCTCCCTTCCCTGC 0: 1
1: 0
2: 7
3: 203
4: 2134
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052577_1042052585 -2 Left 1042052577 8:64727147-64727169 CCCTGCCCACTTAAGGGTTTCCC 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052573_1042052585 12 Left 1042052573 8:64727133-64727155 CCCTGCTGTGCTTTCCCTGCCCA 0: 1
1: 1
2: 6
3: 51
4: 461
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052570_1042052585 26 Left 1042052570 8:64727119-64727141 CCACTTTCTCCCTTCCCTGCTGT 0: 1
1: 1
2: 11
3: 119
4: 1134
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052580_1042052585 -7 Left 1042052580 8:64727152-64727174 CCCACTTAAGGGTTTCCCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052571_1042052585 17 Left 1042052571 8:64727128-64727150 CCCTTCCCTGCTGTGCTTTCCCT 0: 1
1: 0
2: 5
3: 84
4: 824
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052578_1042052585 -3 Left 1042052578 8:64727148-64727170 CCTGCCCACTTAAGGGTTTCCCC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052572_1042052585 16 Left 1042052572 8:64727129-64727151 CCTTCCCTGCTGTGCTTTCCCTG 0: 1
1: 0
2: 4
3: 69
4: 654
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052574_1042052585 11 Left 1042052574 8:64727134-64727156 CCTGCTGTGCTTTCCCTGCCCAC 0: 1
1: 0
2: 3
3: 41
4: 477
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data
1042052582_1042052585 -8 Left 1042052582 8:64727153-64727175 CCACTTAAGGGTTTCCCCTGGGA 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042052585 Original CRISPR CCCTGGGAGTTCTACTTCTG AGG Intronic
No off target data available for this crispr