ID: 1042054480

View in Genome Browser
Species Human (GRCh38)
Location 8:64749455-64749477
Sequence ATCATTTACCTGGATTACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042054480_1042054486 8 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054486 8:64749486-64749508 GCTGGACTGAGGGAGAGCAGTGG No data
1042054480_1042054485 -2 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054485 8:64749476-64749498 ATGATGGCAAGCTGGACTGAGGG No data
1042054480_1042054488 10 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054488 8:64749488-64749510 TGGACTGAGGGAGAGCAGTGGGG No data
1042054480_1042054489 27 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054489 8:64749505-64749527 GTGGGGACAGAAAGAAATAGTGG No data
1042054480_1042054483 -10 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054483 8:64749468-64749490 GGTAAATGATGATGGCAAGCTGG No data
1042054480_1042054484 -3 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054484 8:64749475-64749497 GATGATGGCAAGCTGGACTGAGG No data
1042054480_1042054487 9 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042054480 Original CRISPR ATCATTTACCTGGATTACTA TGG (reversed) Intronic
904066350 1:27754808-27754830 ATAATTTATCTGGAATTCTAAGG + Intronic
908025609 1:59948447-59948469 ATCATATAACTGTACTACTATGG + Intergenic
909709629 1:78633049-78633071 ATCTTTCACCTGGTTTACTGAGG - Intronic
912938806 1:114026717-114026739 ATCACTTACCTAGATGACTGTGG + Intergenic
913129223 1:115824188-115824210 GTCACTTACCTGGATTCCTTAGG - Intergenic
916205298 1:162310711-162310733 ATCATCTACCAGGATGAATAAGG - Intronic
917201541 1:172521706-172521728 AGCATTTACCTGGATAATTAAGG - Intergenic
923180703 1:231516346-231516368 TTCATTTACCAGGGTTATTATGG - Intergenic
1064169041 10:13013599-13013621 GACATTTACTTGGATTACCATGG - Intronic
1067020870 10:42796460-42796482 ATCATTAGCCTGTATTACCAAGG - Exonic
1068400543 10:56521601-56521623 ACCCTTTACCTGTATGACTAAGG - Intergenic
1070000570 10:72373653-72373675 ATCATTTTCCAGGACTTCTAGGG + Intronic
1070491250 10:76978985-76979007 ATCATTTATCTTGATTCCTGAGG + Intronic
1074681350 10:115910701-115910723 GTCATTTAACTTGATTTCTATGG - Intronic
1074993269 10:118731398-118731420 ATCTTGAACCTGGATGACTAAGG - Intronic
1077212439 11:1377854-1377876 ATCATTTAACTGGATAAATTAGG + Intergenic
1077614707 11:3666483-3666505 ATCATGAACCTGCATTACTGTGG - Exonic
1080726417 11:34902957-34902979 ATCATTTCCCAGGATTAGTTTGG - Intronic
1086065683 11:82741758-82741780 ATCATTTGTCTGTATTAGTATGG - Intergenic
1086721305 11:90124711-90124733 ATTATTTACCTTCATTTCTAAGG - Intergenic
1088673353 11:112166507-112166529 AACATTTACATACATTACTAAGG - Intronic
1088724452 11:112621752-112621774 ATCATTTACCTTGATTACCGAGG - Intergenic
1091644635 12:2264332-2264354 TTCATCTCCCTGGATTACTGTGG - Intronic
1091953599 12:4616454-4616476 GTCATTTATCTGGAATCCTAAGG + Intronic
1095605832 12:44066389-44066411 AACATTTAGCTTGTTTACTATGG - Intronic
1099507547 12:83498279-83498301 GTGATTTACTTGGATTAATAGGG - Intergenic
1101869551 12:108553618-108553640 ATCTAGTACCTGGATTATTAGGG - Intronic
1103158198 12:118705752-118705774 ATTATTTATCTTGATTACTGGGG + Intergenic
1106895129 13:34291761-34291783 ATTCTCTACCTGGATAACTAAGG - Intergenic
1107109875 13:36685363-36685385 CTCATCTACCTGGATTTCCAAGG - Intronic
1107243314 13:38263972-38263994 ATAATTTAACAGGATTCCTAAGG + Intergenic
1108133435 13:47328861-47328883 ATGATTACCCTGGATTACTCAGG - Intergenic
1108289309 13:48942437-48942459 ACCATTTATCTAGATCACTATGG + Intergenic
1109722916 13:66299325-66299347 ATCCTTTTTCTGGATTATTATGG - Intergenic
1116591529 14:46781778-46781800 ATCATTTTACTGGATTACTTGGG - Intergenic
1118981986 14:70724554-70724576 ATGATTTACCTTGATTACTGAGG - Intronic
1120403230 14:84060065-84060087 AAAATTTACCAGGATTACAAAGG + Intergenic
1127300917 15:57652774-57652796 ACCATTTCCCTGGATTTCTAGGG + Intronic
1127300969 15:57653341-57653363 ACCATTTCCCTGGATTTCTATGG - Intronic
1127334471 15:57970032-57970054 TTCAATTAACTGGAGTACTAAGG - Intronic
1129863380 15:78881839-78881861 CTCTTTTACCTGGTTTACTATGG + Intronic
1134319859 16:13152906-13152928 AAGATTTTCCTGGATTACCAGGG + Intronic
1135780875 16:25299502-25299524 ATCATCTAACTGCATTAATATGG + Intergenic
1140655434 16:77134850-77134872 ATTCTTTACCTGGCTTACAAAGG + Intergenic
1140797693 16:78455308-78455330 ATCATTTATCTTCATTACTGAGG - Intronic
1141394224 16:83690634-83690656 GCCTCTTACCTGGATTACTATGG - Intronic
1141413851 16:83854992-83855014 ATCAATTATCTGCATTACTTAGG + Intergenic
1143999051 17:11035561-11035583 ATCTTTTAAGAGGATTACTATGG - Intergenic
1149979092 17:61295227-61295249 ATGATTGTGCTGGATTACTAGGG + Intronic
1153132746 18:1875876-1875898 ATTATTGAACTGCATTACTAGGG + Intergenic
1154044658 18:10893533-10893555 AGCATTTACTTGAATTACCAAGG - Intronic
1156361823 18:36390362-36390384 ATCTTTAACCTGGAATACTATGG - Intronic
1156511990 18:37644794-37644816 CTGATTCACCTGTATTACTAGGG - Intergenic
1156588254 18:38456876-38456898 ACCATTTCCTTGGATTACTCTGG + Intergenic
1157775419 18:50391794-50391816 ATCATTTAACTGGATGACCTTGG - Intronic
1158416239 18:57251872-57251894 AACATTGACCTGGATTAGTATGG - Intergenic
1164397812 19:27881083-27881105 ATCATTTCCCAGGATTAATTTGG - Intergenic
1165174787 19:33920550-33920572 ATAATCTACCTGTATTACAAGGG + Intergenic
1166596793 19:44057452-44057474 ATCAGTTCCCTGGAATACTATGG + Intronic
1167415734 19:49370763-49370785 ATCATTTACCTGGACTCCCTAGG - Intronic
925057629 2:867299-867321 TTCATTTACCAGGATTCCTCTGG + Intergenic
928175588 2:29032031-29032053 ATCTTTTTCCTGGACTATTATGG + Intronic
928409296 2:31042147-31042169 ATCCTTTTGCTGGATGACTATGG - Intronic
929406667 2:41650323-41650345 ATCATTTATGTTGATTACTGAGG - Intergenic
931933283 2:67165840-67165862 ATCATTTACATGGAACACCATGG + Intergenic
932020610 2:68082261-68082283 ATCCTTTATCTGAAATACTATGG - Intronic
933036098 2:77400484-77400506 AGTATTTACCTGGATAACCAAGG + Intronic
941496878 2:166216029-166216051 ATCATTCACCATGATTACTTGGG + Intronic
943257764 2:185618298-185618320 ATCATTTTACTGGATTTCTTGGG + Intergenic
943978167 2:194509982-194510004 TTCATTTTAATGGATTACTACGG + Intergenic
945158207 2:206861328-206861350 ATCATTTCCCAGGAATGCTAAGG - Intergenic
947081602 2:226403707-226403729 ATCATTTATTTGGATCACTATGG - Intergenic
1169462319 20:5806429-5806451 ATCATTTTCCTGTATTACTGTGG + Intronic
1170994507 20:21338916-21338938 ATCATGTACCTAGATTTCTGGGG + Intronic
1171230303 20:23479079-23479101 ATCATCTACCTGGATCTCGAGGG - Intergenic
1173047024 20:39522280-39522302 TGCATTTACCTGGTTTACTCGGG - Intergenic
1173078716 20:39845750-39845772 ATCTTTCCCCTGGATAACTACGG - Intergenic
1174506626 20:51021695-51021717 GTCATTTACCTGGGTAACTTTGG + Intronic
1175451231 20:59070364-59070386 ATTATTTACCTTGATTACTGAGG - Intergenic
1175451404 20:59071971-59071993 ATTATTTACCTTGATTACTGAGG + Intergenic
1177070137 21:16494475-16494497 TTCAATTACCTGGATTATTGAGG + Intergenic
1177109683 21:17010269-17010291 ATCATTCACCTGGATGCTTATGG + Intergenic
1181921767 22:26326428-26326450 ATCACTCACATGGATTACTGTGG + Intronic
952159686 3:30681285-30681307 TTCATTTTCCTGGATTTCAAGGG + Intronic
952485842 3:33808637-33808659 ATCTCTTGACTGGATTACTACGG + Intronic
952618842 3:35310861-35310883 TTCATTAGGCTGGATTACTAAGG + Intergenic
953954532 3:47221042-47221064 AACATTTAGATGGATGACTATGG - Intergenic
955446871 3:59021255-59021277 TTTATTTACCTGGAATCCTAAGG - Intronic
957699970 3:83696837-83696859 ATCATTTACCTTGATTAAGTGGG + Intergenic
959454878 3:106547208-106547230 GTTATATACCTGGATTACAAGGG + Intergenic
960058746 3:113297253-113297275 ATTATTTACCTGGAGTAAGATGG - Intronic
960192090 3:114718962-114718984 ATTTTTTTCCTGGATTAATATGG - Intronic
962772910 3:138629876-138629898 ATCAGGTGCTTGGATTACTATGG + Intronic
963153595 3:142072783-142072805 ATCATTTATTTAGATTAGTATGG - Intronic
965572872 3:170189117-170189139 CTCATCTACTAGGATTACTAGGG + Intergenic
968248948 3:197187201-197187223 ATCATGGACCTGGTATACTAAGG - Intronic
974291573 4:59938777-59938799 GTCATTTACCTAGTTTTCTAAGG + Intergenic
975171152 4:71233102-71233124 CTTATTTGCCTGGATTGCTAAGG + Intronic
975652469 4:76607819-76607841 CTCATTTCCATGGATTACCAGGG - Intronic
977990818 4:103439749-103439771 ATCATTTAATTGGATCACCAAGG - Intergenic
981261514 4:142726253-142726275 AACATTTACTTGGAATACAATGG + Intronic
981492869 4:145359187-145359209 ATCATTTATTTGGATCACTATGG - Intergenic
983976762 4:173944444-173944466 ATCATTTTCCTGCATCACCATGG - Intergenic
985334500 4:188877403-188877425 ATCTTTTACCTCTATTTCTAAGG + Intergenic
987737058 5:21859802-21859824 ATGATTGACCTGGATTATCAAGG + Intronic
988258391 5:28850269-28850291 GTGATTTACCTGGACTACAAAGG + Intergenic
989266923 5:39485855-39485877 ATCATTTATCTTAATTACTGAGG - Intergenic
990134566 5:52630180-52630202 ATCATTTTACTGGATTGCAAAGG + Intergenic
992112116 5:73504930-73504952 AAAATTTTCCTGGATTCCTAAGG - Intronic
994061102 5:95477412-95477434 AACATTCTCATGGATTACTATGG + Intronic
994074111 5:95632020-95632042 ATCATTTACTTGGATTGTTTGGG - Intergenic
994257147 5:97611552-97611574 ATCATGTACTTGGATAAATATGG + Intergenic
996115390 5:119612631-119612653 ATCATTTGGCTAGATTACTTGGG + Intronic
998244780 5:140489755-140489777 ATCATTTTACTAGATTATTAGGG + Intronic
998520516 5:142796024-142796046 ATAATTTACTTTGTTTACTAAGG + Intronic
1000431864 5:161162084-161162106 ATCATTTTCCTGGCTTTCCATGG + Intergenic
1004462364 6:15849672-15849694 AACATTTACCTTTATTACTAAGG + Intergenic
1007300270 6:40862780-40862802 GTCTTGTACCTGGACTACTAGGG + Intergenic
1007452076 6:41947791-41947813 ATCTCTTACCTGGATTACAGTGG + Intronic
1009480763 6:64155806-64155828 ATTATTTATCTTGATTACTGAGG + Intronic
1010298449 6:74229410-74229432 ATCATTTACCTGATTTATCATGG - Intergenic
1010352837 6:74895993-74896015 ATCATTTACCATGATTACATGGG - Intergenic
1010911348 6:81561025-81561047 ATCACATACCTGAATTACTCAGG + Intronic
1011423006 6:87194052-87194074 ATCCTTTAGGTGGATAACTAGGG + Intronic
1012724820 6:102797375-102797397 ATCATTTATGACGATTACTATGG - Intergenic
1012783913 6:103599038-103599060 ATCATTTAACTGGACTATTAAGG + Intergenic
1013414238 6:109910395-109910417 CTCATTTACCTGATTCACTATGG - Intergenic
1020511278 7:9060518-9060540 ATCTTTTACCCTGTTTACTATGG - Intergenic
1022808670 7:33847958-33847980 ATTATTTATCTTGATTACTGTGG - Intergenic
1022808683 7:33848232-33848254 ATGATTTATCTTGATTACTGTGG + Intergenic
1028661532 7:93282822-93282844 ATCATTTACTTGGTTTGCTCAGG + Intronic
1031046065 7:116889373-116889395 AACATTTAACTAGTTTACTATGG - Intronic
1031442674 7:121812789-121812811 AACAATTATCTGGATTACAAGGG - Intergenic
1033571282 7:142631257-142631279 ATCATTTACCTTGACCAGTAAGG - Intergenic
1036278017 8:7373363-7373385 TTCATTTAACTGGGTTGCTATGG - Intronic
1036343506 8:7938529-7938551 TTCATTTAACTGGGTTGCTATGG + Intronic
1038708442 8:29919259-29919281 ATTATGTACCTGGACTTCTAGGG + Intergenic
1041079870 8:54206228-54206250 ATCATTTAGCAGGATGACTCTGG + Intergenic
1041473211 8:58234125-58234147 ATTTTTTACCTGGATCACTGTGG - Intergenic
1042054480 8:64749455-64749477 ATCATTTACCTGGATTACTATGG - Intronic
1042112292 8:65393505-65393527 ATCATTGACCTTGATAATTAAGG + Intergenic
1043358533 8:79441852-79441874 AAGATTAACCTGGATTACCAGGG + Intergenic
1043465420 8:80501599-80501621 AACATTTCACAGGATTACTATGG - Intronic
1044463921 8:92481694-92481716 ATCATTTACCTGAACTTATATGG + Intergenic
1045167464 8:99622921-99622943 ATCTCTCACCTAGATTACTAAGG + Intronic
1046327241 8:112664954-112664976 ATAATCTACATGGTTTACTAGGG - Intronic
1046804581 8:118465751-118465773 ATCATATGCATGGAATACTAAGG - Intronic
1047476940 8:125241681-125241703 ACTGTTTACCTGGCTTACTATGG - Intronic
1055544973 9:77360896-77360918 TTTATTTTCCTGGATTACTTTGG + Intronic
1058592539 9:106581039-106581061 ATAATTTACCTGGGATAATATGG + Intergenic
1061687960 9:132299021-132299043 AACTTTTACCTAAATTACTATGG - Intronic
1186928495 X:14360896-14360918 CTAATTTTCCTGGGTTACTAGGG + Intergenic
1187299757 X:18036796-18036818 ATCATTTACCTGTAAAAATAAGG + Intergenic
1187612994 X:20962114-20962136 AAGATTTACCTGGATTACCAGGG - Intergenic
1188049249 X:25464723-25464745 ATCATTTTCCTGGTTTTCTTTGG + Intergenic
1188456427 X:30371768-30371790 ATCCTTTCCCTGCATTCCTATGG + Intergenic
1198308437 X:135405463-135405485 GTGATTTACCCTGATTACTAAGG + Intergenic
1198629625 X:138620511-138620533 ATGATTTTCCTGTAGTACTATGG - Intergenic
1199343618 X:146711977-146711999 ATTGTTAACCTGTATTACTATGG - Intergenic
1202330217 Y:23742827-23742849 ATCAATTACCTGGATTAATATGG - Intergenic
1202540553 Y:25927235-25927257 ATCAATTACCTGGATTAATATGG + Intergenic