ID: 1042054482

View in Genome Browser
Species Human (GRCh38)
Location 8:64749465-64749487
Sequence GCTTGCCATCATCATTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042054482_1042054487 -1 Left 1042054482 8:64749465-64749487 CCAGGTAAATGATGATGGCAAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG No data
1042054482_1042054486 -2 Left 1042054482 8:64749465-64749487 CCAGGTAAATGATGATGGCAAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1042054486 8:64749486-64749508 GCTGGACTGAGGGAGAGCAGTGG No data
1042054482_1042054488 0 Left 1042054482 8:64749465-64749487 CCAGGTAAATGATGATGGCAAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1042054488 8:64749488-64749510 TGGACTGAGGGAGAGCAGTGGGG No data
1042054482_1042054489 17 Left 1042054482 8:64749465-64749487 CCAGGTAAATGATGATGGCAAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1042054489 8:64749505-64749527 GTGGGGACAGAAAGAAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042054482 Original CRISPR GCTTGCCATCATCATTTACC TGG (reversed) Intronic
904400175 1:30251419-30251441 GCTTGGCATGATAATTTATCTGG + Intergenic
904819936 1:33235380-33235402 TATTGCCATCTTCATTTGCCAGG + Intergenic
916880675 1:169016966-169016988 CCTTGCCAACCTCATTTGCCTGG + Intergenic
919935779 1:202249792-202249814 GCCCGCCATCATCACTTGCCTGG + Intronic
920879770 1:209868981-209869003 GCTTGCCACCATTAGTTAACAGG - Intergenic
923477686 1:234350547-234350569 GCTTACCATCATTAGTCACCAGG + Intergenic
923809108 1:237293119-237293141 TTTTGACATCATCATCTACCTGG + Intronic
1067182644 10:44000721-44000743 GCCTGCCATCATGTTTTACCTGG - Intergenic
1074552342 10:114456242-114456264 ACTTATCATCATCATTTACTTGG - Intronic
1076161166 10:128245291-128245313 GCTGGACAACAGCATTTACCAGG - Intergenic
1077896918 11:6459960-6459982 GCATGCCATCAACATTTAGATGG + Intronic
1081553618 11:44137190-44137212 GCTTCCCATCATCAGATACTTGG - Intronic
1082057456 11:47831259-47831281 GCTTGGCATCATTAGTTATCAGG + Intronic
1083077675 11:60057909-60057931 ATTTTCCATCATCATTTATCAGG + Intronic
1083379130 11:62250486-62250508 GCTTGCCATCCTCATCTTCTCGG - Intergenic
1086744448 11:90407540-90407562 TCTTGCCTTCATCCTTTACAGGG - Intergenic
1088450321 11:109974759-109974781 GCTGGCCATCAGCATTTCACAGG + Intergenic
1091752005 12:3028541-3028563 GCTTACCATCATCAGTCATCAGG - Intronic
1093062107 12:14617950-14617972 CCTTGCCAGCATGATTTGCCAGG + Intronic
1095461425 12:42448307-42448329 GCTTGCCATCAGCATTATTCTGG + Intronic
1098164408 12:67678969-67678991 ACTTGCTATTCTCATTTACCTGG - Intergenic
1098588217 12:72181001-72181023 GACTGCCATCAACAATTACCAGG - Intronic
1098894182 12:76038719-76038741 GCTTGCCATAAACATTTCCTGGG - Exonic
1102118796 12:110424529-110424551 GCTTGACCACGTCATTTACCTGG + Intergenic
1103813269 12:123632995-123633017 ACTTTTCATCATCATTTACTCGG - Intronic
1107737020 13:43409930-43409952 GCTTCCCTTCATCATTTACACGG - Intronic
1110687992 13:78397849-78397871 GTTGGCCATCCTAATTTACCAGG - Intergenic
1111015200 13:82371322-82371344 GCTTTCCATCATCATGAAGCAGG - Intergenic
1111221686 13:85213130-85213152 AGTTGCCATCATCTCTTACCTGG - Intergenic
1113402819 13:110010304-110010326 GCTTTCCATCATCTTCTAACTGG - Intergenic
1113638664 13:111941252-111941274 TCTTGCCAGCCTCATTTCCCTGG - Intergenic
1113780048 13:112971376-112971398 TGTTGCCATCAGCTTTTACCTGG - Intronic
1121534380 14:94681237-94681259 CCTTGCCATCATCATACAGCAGG + Intergenic
1121610142 14:95273128-95273150 GCTTTCCATCATAATTTGCAGGG - Intronic
1127645771 15:60957557-60957579 TCTTTCCAACATTATTTACCAGG - Intronic
1128139419 15:65287878-65287900 GCTTCCCATCTTCTTTTGCCAGG + Intronic
1128395968 15:67226104-67226126 GCTTGTCATCATTAGTCACCAGG - Intronic
1131574767 15:93577188-93577210 GCTGGCCATCTTCTTTTTCCTGG + Intergenic
1131803526 15:96097695-96097717 GCTTGCAATCACCTTTCACCAGG - Intergenic
1133750731 16:8723288-8723310 ACTTGCCATCATCCTTCTCCTGG - Intronic
1135417565 16:22280296-22280318 CCTGGCCAGCATCATGTACCGGG - Exonic
1136994625 16:35181363-35181385 GGATGCCATCCTCATTCACCTGG - Intergenic
1138110217 16:54317796-54317818 GCTAGTCCTCATCATGTACCAGG + Intergenic
1138225755 16:55292869-55292891 GCTTGCCATCAAAATTGATCTGG - Intergenic
1138292938 16:55863377-55863399 GGTGGCCATCATCCCTTACCTGG - Exonic
1138364798 16:56466192-56466214 GATTGCCTTCATCCTGTACCTGG + Exonic
1146536040 17:33652988-33653010 GCATGCCAAGATCATTTGCCAGG - Intronic
1155530942 18:26765803-26765825 GCTTACCACCATCATTTTCATGG - Intergenic
1156047554 18:32894183-32894205 GCATTCCATCATCATCTACAGGG - Intergenic
1157075429 18:44461163-44461185 GCATGCAAACATCATTTACAAGG - Intergenic
1160475905 18:79187445-79187467 GCTGGCCAGAATCAGTTACCTGG + Intronic
1164943303 19:32268512-32268534 GCTTAGCAGCATCATTTAGCTGG + Intergenic
1166948272 19:46410469-46410491 GCTTGCCATCCTCATGCCCCGGG - Exonic
925553289 2:5099578-5099600 GCTTGACATCATCAGTCATCAGG - Intergenic
930109353 2:47665377-47665399 GCTTGCCTGCATCATATAGCTGG + Intergenic
930675913 2:54200313-54200335 ACTTGCCCTCATCATATACAAGG + Intronic
939461204 2:142497467-142497489 GCTCACCATCATCAATTATCAGG - Intergenic
939491332 2:142880783-142880805 GCTTGGCATTATCAATTGCCTGG - Intronic
947128449 2:226896520-226896542 AGCTGCCATCATCTTTTACCGGG + Intronic
1174333959 20:49844325-49844347 GCTTGCCATTACCTTTTTCCTGG + Intronic
1174787187 20:53444033-53444055 GCCAGCCATCATCGTTTTCCCGG + Intronic
949371863 3:3343934-3343956 CCATGCCATCATCCTTTGCCTGG + Intergenic
950140778 3:10613687-10613709 GGCTGCCATCATCTCTTACCCGG + Intronic
952751814 3:36831023-36831045 GCTTGCCTTCATCAATGGCCGGG + Exonic
953554508 3:43932944-43932966 CCTGGCATTCATCATTTACCAGG + Intergenic
955093288 3:55772978-55773000 GCTTGCCATCATCTCATGCCTGG + Intronic
957546491 3:81644779-81644801 ACTTGCAATTATCTTTTACCTGG - Intronic
958775227 3:98474458-98474480 GCTTGACATCACTAATTACCAGG - Intergenic
958932852 3:100225998-100226020 GCTTTCCATCATCATCTTACTGG + Intergenic
964008475 3:151860576-151860598 GAATGGCATCATCATTTATCTGG - Intergenic
965121889 3:164570045-164570067 GCTTGACATCACCAATTATCAGG + Intergenic
965500206 3:169446752-169446774 GCTTCTCATGATCATATACCTGG + Intronic
967421762 3:189280968-189280990 GCTTGCCATCATTCTTCTCCTGG - Intronic
969106905 4:4813576-4813598 GCTTGCCATGATCACTTGCCTGG - Intergenic
972522300 4:39870699-39870721 CCTTGACATCATCATTCATCAGG + Intronic
972888013 4:43517088-43517110 GCTTACCACCACCATATACCTGG - Intergenic
975744715 4:77464787-77464809 TCTTGCCAGCAACATTTGCCAGG - Intergenic
976652091 4:87446872-87446894 TCCTGTCATCATCTTTTACCTGG + Intronic
977309998 4:95374175-95374197 ACTTGCCCTCAACATTTGCCGGG + Intronic
978959340 4:114657168-114657190 CCTTGCCATCATCATATCCTCGG + Intronic
980106046 4:128589362-128589384 ACTGGGCATCATCATTTGCCAGG - Intergenic
981650949 4:147058308-147058330 GCTTGGCATCATCCTTTCTCAGG - Intergenic
985914969 5:2910658-2910680 GCTTGCCATCTTCAGCCACCAGG - Intergenic
991357940 5:65789228-65789250 GTCTGGCATCATCATTTACTAGG + Intronic
992495933 5:77293818-77293840 GCTTGCCATCATTTGTCACCAGG - Intronic
996872316 5:128204956-128204978 GCTTGACATCATTATTCATCAGG - Intergenic
997003594 5:129792101-129792123 GCTTGCCATCACTAATTATCAGG - Intergenic
997237526 5:132282135-132282157 GCATGCCATTATCATTTGACAGG + Intronic
1002441163 5:179265266-179265288 CCTTGCCAGCCACATTTACCTGG + Intronic
1006464985 6:34187911-34187933 GCTGGCCATCCTCCTTTGCCTGG - Intergenic
1008050655 6:46897544-46897566 GCTTCCTTTCATCATTTTCCTGG + Intronic
1011037899 6:82997926-82997948 GAATGCCTTCACCATTTACCTGG + Intronic
1011585081 6:88916012-88916034 GCTTAACATCATCAATTATCAGG + Intronic
1016420954 6:143882609-143882631 GCTTATCATCATCATTTTCTTGG + Intronic
1018141543 6:160842499-160842521 GTGTGCCATCATCATTTCTCTGG + Intergenic
1019221806 6:170479006-170479028 CCTTCCCATCATCACTTAGCTGG + Intergenic
1023512861 7:40971439-40971461 GGTTCTCATCATCATTTGCCTGG - Intergenic
1024991979 7:55241963-55241985 TTTTGCCATCATCATTTATTTGG - Intronic
1033928629 7:146495491-146495513 GCTTGCCTTCATTATTTTGCAGG - Intronic
1037751755 8:21686855-21686877 GCTTGCCATCCTGATTTTGCTGG - Intergenic
1038046088 8:23766560-23766582 GGTTGCCATCATCTTGTACCTGG + Intergenic
1039029273 8:33292165-33292187 AATTACCATCATCCTTTACCTGG + Intergenic
1041029983 8:53727177-53727199 CCTTGCCTCCATCAATTACCTGG + Intronic
1041103800 8:54422155-54422177 GCTTAACATCATTATTTACTGGG - Intergenic
1041718155 8:60950704-60950726 GCTTGCCATCATCAGTTTGGAGG + Intergenic
1041791820 8:61704723-61704745 GCTTGACATCATTATTCATCAGG + Intronic
1042054482 8:64749465-64749487 GCTTGCCATCATCATTTACCTGG - Intronic
1046389627 8:113553097-113553119 GCTTATCATCATCATTTATTTGG + Intergenic
1047944380 8:129859898-129859920 GCTTGCCGCCCACATTTACCAGG + Intronic
1048739933 8:137545256-137545278 GCATGCCTTCATCATTCACTGGG + Intergenic
1049316992 8:141974650-141974672 CGTTGCCATCATCATTTTCACGG + Intergenic
1052353479 9:27481306-27481328 GTTTGCCATCATCTTTTAGCTGG - Intronic
1052647447 9:31254425-31254447 GCAGGCCATCATCATCTACCAGG + Intergenic
1062445837 9:136594075-136594097 GCTTGCCATCATTAGTTAGCAGG + Intergenic
1185610103 X:1389274-1389296 GCAGGGCATCATCATCTACCGGG - Exonic
1200307661 X:155044612-155044634 GCTTAGCATCATCAATTATCAGG + Intronic