ID: 1042054487

View in Genome Browser
Species Human (GRCh38)
Location 8:64749487-64749509
Sequence CTGGACTGAGGGAGAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042054480_1042054487 9 Left 1042054480 8:64749455-64749477 CCATAGTAATCCAGGTAAATGAT 0: 1
1: 0
2: 2
3: 18
4: 140
Right 1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG No data
1042054482_1042054487 -1 Left 1042054482 8:64749465-64749487 CCAGGTAAATGATGATGGCAAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042054487 Original CRISPR CTGGACTGAGGGAGAGCAGT GGG Intronic
No off target data available for this crispr