ID: 1042054487 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:64749487-64749509 |
| Sequence | CTGGACTGAGGGAGAGCAGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042054480_1042054487 | 9 | Left | 1042054480 | 8:64749455-64749477 | CCATAGTAATCCAGGTAAATGAT | 0: 1 1: 0 2: 2 3: 18 4: 140 |
||
| Right | 1042054487 | 8:64749487-64749509 | CTGGACTGAGGGAGAGCAGTGGG | No data | ||||
| 1042054482_1042054487 | -1 | Left | 1042054482 | 8:64749465-64749487 | CCAGGTAAATGATGATGGCAAGC | 0: 1 1: 0 2: 0 3: 7 4: 108 |
||
| Right | 1042054487 | 8:64749487-64749509 | CTGGACTGAGGGAGAGCAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042054487 | Original CRISPR | CTGGACTGAGGGAGAGCAGT GGG | Intronic | ||
| No off target data available for this crispr | |||||