ID: 1042059978

View in Genome Browser
Species Human (GRCh38)
Location 8:64806037-64806059
Sequence CTGTGTTCTCAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042059978_1042059979 -7 Left 1042059978 8:64806037-64806059 CCTCTCTGCTTCTGAGAACACAG No data
Right 1042059979 8:64806053-64806075 AACACAGCAGTCACATTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042059978 Original CRISPR CTGTGTTCTCAGAAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr