ID: 1042061954

View in Genome Browser
Species Human (GRCh38)
Location 8:64828244-64828266
Sequence TGATTCCAGATTTCAAGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042061954_1042061955 2 Left 1042061954 8:64828244-64828266 CCTTAACTTGAAATCTGGAATCA No data
Right 1042061955 8:64828269-64828291 GAACAAGATTTATATATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042061954 Original CRISPR TGATTCCAGATTTCAAGTTA AGG (reversed) Intergenic
No off target data available for this crispr