ID: 1042065406

View in Genome Browser
Species Human (GRCh38)
Location 8:64869536-64869558
Sequence TTGGACACATAACTCCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042065402_1042065406 -2 Left 1042065402 8:64869515-64869537 CCACAGCTGAATAGACCAGTGTT No data
Right 1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG No data
1042065400_1042065406 6 Left 1042065400 8:64869507-64869529 CCCACTGACCACAGCTGAATAGA No data
Right 1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG No data
1042065399_1042065406 7 Left 1042065399 8:64869506-64869528 CCCCACTGACCACAGCTGAATAG No data
Right 1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG No data
1042065401_1042065406 5 Left 1042065401 8:64869508-64869530 CCACTGACCACAGCTGAATAGAC No data
Right 1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042065406 Original CRISPR TTGGACACATAACTCCACCT GGG Intergenic
No off target data available for this crispr