ID: 1042065689

View in Genome Browser
Species Human (GRCh38)
Location 8:64873087-64873109
Sequence CAATGAGGACAAAAGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042065689_1042065692 -3 Left 1042065689 8:64873087-64873109 CCAAGTTCCTTTTGTCCTCATTG No data
Right 1042065692 8:64873107-64873129 TTGCAACGAAATGATTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042065689 Original CRISPR CAATGAGGACAAAAGGAACT TGG (reversed) Intergenic
No off target data available for this crispr