ID: 1042065692

View in Genome Browser
Species Human (GRCh38)
Location 8:64873107-64873129
Sequence TTGCAACGAAATGATTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042065690_1042065692 -10 Left 1042065690 8:64873094-64873116 CCTTTTGTCCTCATTGCAACGAA No data
Right 1042065692 8:64873107-64873129 TTGCAACGAAATGATTCATGTGG No data
1042065689_1042065692 -3 Left 1042065689 8:64873087-64873109 CCAAGTTCCTTTTGTCCTCATTG No data
Right 1042065692 8:64873107-64873129 TTGCAACGAAATGATTCATGTGG No data
1042065688_1042065692 4 Left 1042065688 8:64873080-64873102 CCTAGCACCAAGTTCCTTTTGTC No data
Right 1042065692 8:64873107-64873129 TTGCAACGAAATGATTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042065692 Original CRISPR TTGCAACGAAATGATTCATG TGG Intergenic
No off target data available for this crispr