ID: 1042066581

View in Genome Browser
Species Human (GRCh38)
Location 8:64883836-64883858
Sequence TGGTTTGAAGGACCTTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042066581_1042066586 10 Left 1042066581 8:64883836-64883858 CCTAAGGAAGGTCCTTCAAACCA No data
Right 1042066586 8:64883869-64883891 TGAACACTAGTGCCCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042066581 Original CRISPR TGGTTTGAAGGACCTTCCTT AGG (reversed) Intergenic
No off target data available for this crispr